Incidental Mutation 'R1867:Focad'
ID208814
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #R1867 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88178089 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 236 (D236V)
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: D236V
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: D236V

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159342
AA Change: D236V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: D236V

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161058
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
Abca4 T A 3: 122,105,361 I664N probably damaging Het
Acin1 T C 14: 54,644,261 D335G probably damaging Het
Acoxl A G 2: 127,877,787 Y156C probably damaging Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Ago1 A G 4: 126,441,236 Y398H probably damaging Het
Aldob A G 4: 49,543,835 V49A possibly damaging Het
Arhgap18 A G 10: 26,846,030 E71G probably damaging Het
Asb12 G T X: 95,470,344 H307N probably damaging Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
AY358078 T C 14: 51,800,047 M1T probably null Het
BC117090 T G 16: 36,321,786 D76A possibly damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Brpf3 A G 17: 28,807,368 M472V probably benign Het
Bsn A G 9: 108,106,719 S3379P unknown Het
Cap2 T C 13: 46,640,079 V333A probably damaging Het
Ccdc173 A T 2: 69,781,837 probably null Het
Cd207 T A 6: 83,675,653 D165V probably damaging Het
Cmtr1 A G 17: 29,674,174 T496A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Cstb A G 10: 78,427,439 *99W probably null Het
Ddx11 G A 17: 66,135,939 probably null Het
Dip2c T C 13: 9,621,949 M990T possibly damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Fmn1 A G 2: 113,709,438 E1326G probably damaging Het
Fsd1 G A 17: 55,991,254 S193N probably benign Het
Gm4922 T A 10: 18,784,463 R170S possibly damaging Het
Gm5129 T C 5: 29,735,656 probably benign Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Hspbap1 A T 16: 35,801,564 Y93F possibly damaging Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Il1rap A T 16: 26,722,926 H639L probably damaging Het
Inhbc A T 10: 127,357,547 V200E probably benign Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Kif23 C A 9: 61,918,961 A929S possibly damaging Het
Kmt2b A T 7: 30,574,658 V2207E possibly damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lpl TGG TG 8: 68,896,602 probably null Het
Mcmdc2 T C 1: 9,930,805 V435A probably damaging Het
Mecom A G 3: 30,509,428 probably null Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mmp16 A T 4: 18,116,013 D539V probably benign Het
Mpp1 A G X: 75,125,369 probably null Het
Mpp2 C T 11: 102,064,667 E86K probably benign Het
Mtor T A 4: 148,454,632 F195L probably damaging Het
Myo3a T C 2: 22,399,846 I663T probably benign Het
Nlrp5 G A 7: 23,423,982 G756E possibly damaging Het
Nudt18 T C 14: 70,579,895 L255P probably damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr659 T A 7: 104,671,317 I205N possibly damaging Het
Olfr798 A T 10: 129,625,752 I103K probably damaging Het
Olfr835 G A 9: 19,035,266 A48T probably benign Het
Oosp2 C T 19: 11,649,595 probably null Het
Pan2 A G 10: 128,313,181 D506G probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Pcdhgc5 T G 18: 37,821,418 S582A possibly damaging Het
Pdik1l T C 4: 134,278,911 D70G probably damaging Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Pms1 C T 1: 53,189,387 V901I probably benign Het
Pnisr C T 4: 21,874,086 probably benign Het
Pole A G 5: 110,334,197 E135G probably benign Het
Ppp6r2 C A 15: 89,281,938 A715E probably benign Het
Prickle4 T G 17: 47,690,119 H174P possibly damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Prss32 C T 17: 23,853,894 T33M probably benign Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rbbp6 T C 7: 122,997,029 V598A probably damaging Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rbm4b A G 19: 4,762,303 T247A probably benign Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Sema4f T C 6: 82,917,843 D457G possibly damaging Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Serpina3a A T 12: 104,118,627 I94L probably benign Het
Skida1 TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 2: 18,046,344 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Sntg2 T C 12: 30,236,651 N315D probably benign Het
Snx10 T A 6: 51,575,910 V11E probably damaging Het
Spta1 A G 1: 174,219,839 E1683G probably benign Het
Ssc5d A T 7: 4,928,507 R238W probably damaging Het
Ssh1 A T 5: 113,943,451 F617L probably damaging Het
Taf1 T G X: 101,562,957 M1254R probably damaging Het
Tcirg1 A G 19: 3,898,835 L450P probably damaging Het
Ticam1 C A 17: 56,271,718 A126S probably benign Het
Tnxb T A 17: 34,671,847 V388E probably damaging Het
Tomm5 A G 4: 45,107,939 L32P probably damaging Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp28 T G 9: 49,009,194 D240E probably benign Het
Usp34 T C 11: 23,361,593 Y462H possibly damaging Het
Utp14b C A 1: 78,665,431 Q349K probably damaging Het
Utp20 G T 10: 88,749,443 D2586E probably benign Het
Vmn1r173 A G 7: 23,703,235 I298M unknown Het
Vmn1r37 T A 6: 66,731,477 I29K probably benign Het
Vmn2r23 G A 6: 123,702,915 G32D probably damaging Het
Xpo7 A T 14: 70,693,991 F296I probably damaging Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp455 G T 13: 67,207,445 R194L probably benign Het
Zfp663 T C 2: 165,352,731 T523A possibly damaging Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
Microscope UTSW 4 88342204 missense unknown
Objective UTSW 4 88401068 nonsense probably null
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1109:Focad UTSW 4 88196747 intron probably benign
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2176:Focad UTSW 4 88279244 missense unknown
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R2431:Focad UTSW 4 88331027 missense unknown
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3196:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4788:Focad UTSW 4 88357469 missense unknown
R4923:Focad UTSW 4 88196846 intron probably benign
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6543:Focad UTSW 4 88279256 missense unknown
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R6928:Focad UTSW 4 88348875 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
R7242:Focad UTSW 4 88309906 missense unknown
R7357:Focad UTSW 4 88229335 missense probably benign 0.19
R7380:Focad UTSW 4 88274198 missense unknown
R7427:Focad UTSW 4 88368751 missense unknown
R7582:Focad UTSW 4 88229378 missense probably benign 0.00
R7661:Focad UTSW 4 88303535 missense unknown
R7688:Focad UTSW 4 88178133 missense probably damaging 1.00
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCACACTTTTGTTCCATTGAAAACC -3'
(R):5'- CAACACTGCGCTCTAAAAGGTG -3'

Sequencing Primer
(F):5'- TCTGGGGATGACTCATATCCCAAG -3'
(R):5'- GGTGAATTAAAGATGAGCACTCCCC -3'
Posted On2014-06-30