Incidental Mutation 'R0117:Fig4'
ID 20883
Institutional Source Beutler Lab
Gene Symbol Fig4
Ensembl Gene ENSMUSG00000038417
Gene Name FIG4 phosphoinositide 5-phosphatase
Synonyms A530089I17Rik
MMRRC Submission 038403-MU
Accession Numbers

Ncbi RefSeq: NM_133999.1; MGI:2143585
Essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R0117 (G1)
Quality Score 151
Status Validated (trace)
Chromosome 10
Chromosomal Location 41188172-41303260 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 41230041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 716 (R716*)
Ref Sequence ENSEMBL: ENSMUSP00000039598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043814]
AlphaFold Q91WF7
Predicted Effect probably null
Transcript: ENSMUST00000043814
AA Change: R716*
SMART Domains Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: R716*

DomainStartEndE-ValueType
Pfam:Syja_N 93 424 1.7e-79 PFAM
Blast:Lactamase_B 533 610 6e-21 BLAST
low complexity region 742 771 N/A INTRINSIC
low complexity region 805 813 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype Strain: 3716838
Lethality: D30-D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Fig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Fig4 APN 10 41251788 missense probably damaging 0.99
IGL01013:Fig4 APN 10 41267786 missense probably benign 0.00
IGL01066:Fig4 APN 10 41285417 splice site probably benign
IGL01501:Fig4 APN 10 41270374 missense probably benign
IGL01503:Fig4 APN 10 41256518 missense probably benign 0.00
IGL01535:Fig4 APN 10 41256494 missense probably benign 0.00
IGL01733:Fig4 APN 10 41277393 missense possibly damaging 0.49
IGL01782:Fig4 APN 10 41270400 missense probably benign 0.18
IGL01866:Fig4 APN 10 41232164 missense possibly damaging 0.77
IGL01934:Fig4 APN 10 41228112 missense probably benign 0.03
IGL01966:Fig4 APN 10 41232102 splice site probably null
IGL02032:Fig4 APN 10 41303006 missense probably benign 0.00
IGL02225:Fig4 APN 10 41256452 missense probably benign
IGL02345:Fig4 APN 10 41267774 missense probably null 1.00
IGL02532:Fig4 APN 10 41285281 splice site probably benign
IGL02686:Fig4 APN 10 41264004 missense probably damaging 0.99
IGL02965:Fig4 APN 10 41285665 missense probably damaging 0.98
P0021:Fig4 UTSW 10 41251825 missense probably damaging 1.00
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0144:Fig4 UTSW 10 41258049 missense probably damaging 0.99
R0655:Fig4 UTSW 10 41285677 missense probably damaging 1.00
R0701:Fig4 UTSW 10 41240512 nonsense probably null
R0751:Fig4 UTSW 10 41272982 missense probably damaging 1.00
R1540:Fig4 UTSW 10 41188586 missense possibly damaging 0.60
R1586:Fig4 UTSW 10 41265427 missense probably damaging 0.99
R2916:Fig4 UTSW 10 41258075 missense probably damaging 0.98
R3927:Fig4 UTSW 10 41263139 missense probably benign
R4304:Fig4 UTSW 10 41256427 missense probably benign 0.01
R4586:Fig4 UTSW 10 41188632 missense probably damaging 1.00
R4678:Fig4 UTSW 10 41272998 missense probably benign 0.27
R4858:Fig4 UTSW 10 41233590 missense probably benign 0.00
R5614:Fig4 UTSW 10 41272985 missense probably damaging 0.98
R5896:Fig4 UTSW 10 41254885 missense possibly damaging 0.67
R6126:Fig4 UTSW 10 41265447 missense probably damaging 0.99
R7056:Fig4 UTSW 10 41220932 missense probably benign 0.09
R7350:Fig4 UTSW 10 41251756 missense probably benign 0.03
R7452:Fig4 UTSW 10 41240637 missense possibly damaging 0.88
R7481:Fig4 UTSW 10 41230005 critical splice donor site probably null
R7610:Fig4 UTSW 10 41253713 missense probably damaging 1.00
R7818:Fig4 UTSW 10 41263166 missense probably damaging 0.98
R7830:Fig4 UTSW 10 41256466 missense probably benign 0.00
R8263:Fig4 UTSW 10 41267715 nonsense probably null
R8319:Fig4 UTSW 10 41263101 missense probably damaging 1.00
R8409:Fig4 UTSW 10 41265431 missense probably benign 0.01
R8435:Fig4 UTSW 10 41285674 missense probably benign
R8474:Fig4 UTSW 10 41232174 missense probably benign 0.30
R9086:Fig4 UTSW 10 41285403 missense possibly damaging 0.50
R9131:Fig4 UTSW 10 41265411 missense possibly damaging 0.95
R9248:Fig4 UTSW 10 41277482 missense probably benign
R9401:Fig4 UTSW 10 41267737 missense probably benign
R9564:Fig4 UTSW 10 41285391 missense probably benign 0.20
R9627:Fig4 UTSW 10 41232182 missense probably benign 0.01
R9649:Fig4 UTSW 10 41267767 missense probably benign 0.00
Z1088:Fig4 UTSW 10 41253731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAACATTTCAGTGGCCCCAG -3'
(R):5'- ACGTTTAGAACTTCTCAGCTCCTGC -3'

Sequencing Primer
(F):5'- TGGCCCCAGTGCTATAAATAAG -3'
(R):5'- TGGACATCACCCAGAGCTATTAG -3'
Posted On 2013-04-11