Incidental Mutation 'R1867:Vmn2r23'
ID 208830
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R1867 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123679874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 32 (G32D)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: G32D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: G32D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,157,560 (GRCm39) M1K probably null Het
Abca4 T A 3: 121,899,010 (GRCm39) I664N probably damaging Het
Acin1 T C 14: 54,881,718 (GRCm39) D335G probably damaging Het
Acoxl A G 2: 127,719,707 (GRCm39) Y156C probably damaging Het
Adamts20 A G 15: 94,236,340 (GRCm39) F844L probably benign Het
Ago1 A G 4: 126,335,029 (GRCm39) Y398H probably damaging Het
Aldob A G 4: 49,543,835 (GRCm39) V49A possibly damaging Het
Arhgap18 A G 10: 26,722,026 (GRCm39) E71G probably damaging Het
Asb12 G T X: 94,513,950 (GRCm39) H307N probably damaging Het
Atp2b1 T C 10: 98,832,750 (GRCm39) V417A probably damaging Het
AY358078 T C 14: 52,037,504 (GRCm39) M1T probably null Het
Bcl2l15 A G 3: 103,745,914 (GRCm39) probably null Het
Brpf3 A G 17: 29,026,342 (GRCm39) M472V probably benign Het
Bsn A G 9: 107,983,918 (GRCm39) S3379P unknown Het
Cap2 T C 13: 46,793,555 (GRCm39) V333A probably damaging Het
Cd207 T A 6: 83,652,635 (GRCm39) D165V probably damaging Het
Cfap210 A T 2: 69,612,181 (GRCm39) probably null Het
Cmtr1 A G 17: 29,893,148 (GRCm39) T496A probably benign Het
Col14a1 T A 15: 55,310,858 (GRCm39) probably benign Het
Cstb A G 10: 78,263,273 (GRCm39) *99W probably null Het
Cstdc6 T G 16: 36,142,148 (GRCm39) D76A possibly damaging Het
Ddx11 G A 17: 66,442,934 (GRCm39) probably null Het
Dip2c T C 13: 9,671,985 (GRCm39) M990T possibly damaging Het
Epc2 A G 2: 49,422,117 (GRCm39) Y337C probably damaging Het
Fmn1 A G 2: 113,539,783 (GRCm39) E1326G probably damaging Het
Focad A T 4: 88,096,326 (GRCm39) D236V probably damaging Het
Fsd1 G A 17: 56,298,254 (GRCm39) S193N probably benign Het
Gm4922 T A 10: 18,660,211 (GRCm39) R170S possibly damaging Het
Gm5129 T C 5: 29,940,654 (GRCm39) probably benign Het
Gucy2d T A 7: 98,103,268 (GRCm39) L504H probably damaging Het
Hspbap1 A T 16: 35,621,934 (GRCm39) Y93F possibly damaging Het
Iars2 A T 1: 185,050,765 (GRCm39) D441E probably benign Het
Il1rap A T 16: 26,541,676 (GRCm39) H639L probably damaging Het
Inhbc A T 10: 127,193,416 (GRCm39) V200E probably benign Het
Ints8 C A 4: 11,241,684 (GRCm39) C253F probably damaging Het
Intu G T 3: 40,618,765 (GRCm39) G257V probably damaging Het
Kif23 C A 9: 61,826,243 (GRCm39) A929S possibly damaging Het
Kmt2b A T 7: 30,274,083 (GRCm39) V2207E possibly damaging Het
Ksr2 A C 5: 117,643,594 (GRCm39) E121A probably benign Het
Lce1b A G 3: 92,563,318 (GRCm39) S72P unknown Het
Lpl TGG TG 8: 69,349,254 (GRCm39) probably null Het
Mcmdc2 T C 1: 10,001,030 (GRCm39) V435A probably damaging Het
Mecom A G 3: 30,563,577 (GRCm39) probably null Het
Mier2 A G 10: 79,384,664 (GRCm39) V150A probably damaging Het
Mmp16 A T 4: 18,116,013 (GRCm39) D539V probably benign Het
Mpp1 A G X: 74,168,975 (GRCm39) probably null Het
Mpp2 C T 11: 101,955,493 (GRCm39) E86K probably benign Het
Mtor T A 4: 148,539,089 (GRCm39) F195L probably damaging Het
Myo3a T C 2: 22,404,657 (GRCm39) I663T probably benign Het
Nlrp5 G A 7: 23,123,407 (GRCm39) G756E possibly damaging Het
Nudt18 T C 14: 70,817,335 (GRCm39) L255P probably damaging Het
Nup62 T A 7: 44,478,472 (GRCm39) S162R possibly damaging Het
Oosp2 C T 19: 11,626,959 (GRCm39) probably null Het
Or52n20 T A 7: 104,320,524 (GRCm39) I205N possibly damaging Het
Or6c66 A T 10: 129,461,621 (GRCm39) I103K probably damaging Het
Or7g20 G A 9: 18,946,562 (GRCm39) A48T probably benign Het
Or8h7 A G 2: 86,720,956 (GRCm39) S188P probably damaging Het
Pan2 A G 10: 128,149,050 (GRCm39) D506G probably damaging Het
Pcdh9 G A 14: 94,125,471 (GRCm39) S233L probably damaging Het
Pcdhgc5 T G 18: 37,954,471 (GRCm39) S582A possibly damaging Het
Pdik1l T C 4: 134,006,222 (GRCm39) D70G probably damaging Het
Peg12 T C 7: 62,113,416 (GRCm39) H227R probably benign Het
Pms1 C T 1: 53,228,546 (GRCm39) V901I probably benign Het
Pnisr C T 4: 21,874,086 (GRCm39) probably benign Het
Pole A G 5: 110,482,063 (GRCm39) E135G probably benign Het
Ppp6r2 C A 15: 89,166,141 (GRCm39) A715E probably benign Het
Prickle4 T G 17: 48,001,044 (GRCm39) H174P possibly damaging Het
Prl2a1 T C 13: 27,988,923 (GRCm39) L16P probably damaging Het
Prss32 C T 17: 24,072,868 (GRCm39) T33M probably benign Het
Psmd13 C T 7: 140,463,430 (GRCm39) T38I probably damaging Het
Rai14 C A 15: 10,633,314 (GRCm39) Q25H probably damaging Het
Rbbp6 T C 7: 122,596,252 (GRCm39) V598A probably damaging Het
Rbm34 C A 8: 127,697,631 (GRCm39) A27S probably benign Het
Rbm4b A G 19: 4,812,331 (GRCm39) T247A probably benign Het
Riiad1 G A 3: 94,380,176 (GRCm39) P40S possibly damaging Het
Sema4f T C 6: 82,894,824 (GRCm39) D457G possibly damaging Het
Sema6c A T 3: 95,078,099 (GRCm39) I492F probably damaging Het
Serpina3a A T 12: 104,084,886 (GRCm39) I94L probably benign Het
Skida1 TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 2: 18,051,155 (GRCm39) probably benign Het
Slc38a1 G A 15: 96,485,016 (GRCm39) T221M probably damaging Het
Slc6a17 T A 3: 107,379,492 (GRCm39) M559L probably damaging Het
Sntg2 T C 12: 30,286,650 (GRCm39) N315D probably benign Het
Snx10 T A 6: 51,552,890 (GRCm39) V11E probably damaging Het
Spta1 A G 1: 174,047,405 (GRCm39) E1683G probably benign Het
Ssc5d A T 7: 4,931,506 (GRCm39) R238W probably damaging Het
Ssh1 A T 5: 114,081,512 (GRCm39) F617L probably damaging Het
Taf1 T G X: 100,606,563 (GRCm39) M1254R probably damaging Het
Tcirg1 A G 19: 3,948,835 (GRCm39) L450P probably damaging Het
Ticam1 C A 17: 56,578,718 (GRCm39) A126S probably benign Het
Tnxb T A 17: 34,890,821 (GRCm39) V388E probably damaging Het
Tomm5 A G 4: 45,107,939 (GRCm39) L32P probably damaging Het
Ubr5 A T 15: 38,042,090 (GRCm39) S169T probably benign Het
Usp28 T G 9: 48,920,494 (GRCm39) D240E probably benign Het
Usp34 T C 11: 23,311,593 (GRCm39) Y462H possibly damaging Het
Utp14b C A 1: 78,643,148 (GRCm39) Q349K probably damaging Het
Utp20 G T 10: 88,585,305 (GRCm39) D2586E probably benign Het
Vmn1r173 A G 7: 23,402,660 (GRCm39) I298M unknown Het
Vmn1r37 T A 6: 66,708,461 (GRCm39) I29K probably benign Het
Xpo7 A T 14: 70,931,431 (GRCm39) F296I probably damaging Het
Zfhx4 A G 3: 5,477,774 (GRCm39) E3463G probably damaging Het
Zfp455 G T 13: 67,355,509 (GRCm39) R194L probably benign Het
Zfp663 T C 2: 165,194,651 (GRCm39) T523A possibly damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTTGACCCACATGGACCAG -3'
(R):5'- ACTCCATGAAGTTGAAGACAGG -3'

Sequencing Primer
(F):5'- GGACCAGAAAGGCACATGTTTTATC -3'
(R):5'- CATGAAGTTGAAGACAGGAGACATTG -3'
Posted On 2014-06-30