Incidental Mutation 'R0117:Mcm9'
ID20884
Institutional Source Beutler Lab
Gene Symbol Mcm9
Ensembl Gene ENSMUSG00000058298
Gene Nameminichromosome maintenance 9 homologous recombination repair factor
SynonymsMcmdc1, 9030408O17Rik
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0117 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location53536315-53630439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53537736 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 416 (V416A)
Ref Sequence ENSEMBL: ENSMUSP00000151956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075540] [ENSMUST00000219547] [ENSMUST00000220007]
Predicted Effect probably benign
Transcript: ENSMUST00000075540
AA Change: V1154A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074978
Gene: ENSMUSG00000058298
AA Change: V1154A

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 81 111 N/A INTRINSIC
MCM 268 761 9.44e-116 SMART
AAA 500 649 2.43e-6 SMART
coiled coil region 789 817 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1028 N/A INTRINSIC
low complexity region 1045 1056 N/A INTRINSIC
low complexity region 1199 1216 N/A INTRINSIC
low complexity region 1219 1232 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219547
AA Change: V416A

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220007
AA Change: V416A

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the mini-chromosome maintenance (MCM) protein family that are essential for the initiation of eukaryotic genome replication. Binding of this protein to chromatin has been shown to be a pre-requisite for recruiting the MCM2-7 helicase to DNA replication origins. This protein also binds, and is a positive regulator of, the chromatin licensing and DNA replication factor 1, CDT1. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for gene trap alleles display germ cell loss with reduced fertility or infertility and increased tumor incidence, particulary of hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Mcm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Mcm9 APN 10 53622973 missense probably damaging 0.97
IGL00904:Mcm9 APN 10 53622921 missense possibly damaging 0.89
IGL00943:Mcm9 APN 10 53548589 missense probably damaging 1.00
IGL01019:Mcm9 APN 10 53629945 missense probably damaging 1.00
IGL02452:Mcm9 APN 10 53541557 missense probably damaging 1.00
IGL02481:Mcm9 APN 10 53625937 missense probably damaging 1.00
IGL02982:Mcm9 APN 10 53625826 missense probably damaging 0.99
IGL03300:Mcm9 APN 10 53611427 missense probably damaging 1.00
R0021:Mcm9 UTSW 10 53537901 missense possibly damaging 0.94
R0137:Mcm9 UTSW 10 53563430 missense possibly damaging 0.95
R0420:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R0499:Mcm9 UTSW 10 53538154 missense probably benign 0.01
R0543:Mcm9 UTSW 10 53541598 missense probably damaging 0.97
R0947:Mcm9 UTSW 10 53537501 small deletion probably benign
R0975:Mcm9 UTSW 10 53538646 nonsense probably null
R1573:Mcm9 UTSW 10 53548656 missense probably damaging 0.97
R1726:Mcm9 UTSW 10 53537881 missense possibly damaging 0.67
R1839:Mcm9 UTSW 10 53541553 missense probably damaging 0.99
R2050:Mcm9 UTSW 10 53612825 critical splice donor site probably null
R2113:Mcm9 UTSW 10 53615847 splice site probably null
R2172:Mcm9 UTSW 10 53548574 missense probably damaging 1.00
R3417:Mcm9 UTSW 10 53537407 missense possibly damaging 0.83
R3755:Mcm9 UTSW 10 53625952 missense probably benign 0.08
R3787:Mcm9 UTSW 10 53615980 missense possibly damaging 0.78
R3789:Mcm9 UTSW 10 53616017 missense probably damaging 1.00
R3953:Mcm9 UTSW 10 53563344 missense probably damaging 1.00
R4291:Mcm9 UTSW 10 53547572 missense probably benign 0.22
R4358:Mcm9 UTSW 10 53537653 missense probably benign 0.03
R4660:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R4662:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R5082:Mcm9 UTSW 10 53538060 missense possibly damaging 0.94
R5130:Mcm9 UTSW 10 53630399 missense possibly damaging 0.90
R5193:Mcm9 UTSW 10 53616038 missense probably damaging 0.99
R5238:Mcm9 UTSW 10 53629997 missense possibly damaging 0.83
R5317:Mcm9 UTSW 10 53538234 missense probably damaging 1.00
R5395:Mcm9 UTSW 10 53538692 missense possibly damaging 0.93
R5524:Mcm9 UTSW 10 53548690 nonsense probably null
R5593:Mcm9 UTSW 10 53538297 missense probably damaging 0.99
R5748:Mcm9 UTSW 10 53625729 missense probably damaging 1.00
R6025:Mcm9 UTSW 10 53615977 missense possibly damaging 0.93
R6299:Mcm9 UTSW 10 53537681 missense probably damaging 1.00
R6344:Mcm9 UTSW 10 53537937 missense probably benign 0.03
R6502:Mcm9 UTSW 10 53612839 missense probably damaging 1.00
R6621:Mcm9 UTSW 10 53563313 missense probably damaging 1.00
R6883:Mcm9 UTSW 10 53616014 missense probably damaging 1.00
R6932:Mcm9 UTSW 10 53620203 missense probably benign 0.06
R6963:Mcm9 UTSW 10 53548617 missense probably damaging 1.00
R7094:Mcm9 UTSW 10 53620157 missense probably damaging 1.00
R7114:Mcm9 UTSW 10 53538573 missense possibly damaging 0.55
R7200:Mcm9 UTSW 10 53615923 missense
R7593:Mcm9 UTSW 10 53629992 missense probably benign 0.04
R7671:Mcm9 UTSW 10 53537569 missense probably benign 0.01
R7697:Mcm9 UTSW 10 53615894 missense
R7997:Mcm9 UTSW 10 53597406 start gained probably benign
R8136:Mcm9 UTSW 10 53611343 makesense probably null
R8137:Mcm9 UTSW 10 53622980 missense
Z1176:Mcm9 UTSW 10 53537507 missense unknown
Z1176:Mcm9 UTSW 10 53629788 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTGAAGGAGAAGCTTGCCAGTCTG -3'
(R):5'- GTGATGAAGAAGACTCTGTGCCCC -3'

Sequencing Primer
(F):5'- AAGCTTGCCAGTCTGGCTATG -3'
(R):5'- TACCTCCCAGTGCTAGTGAAATAG -3'
Posted On2013-04-11