Mutagenetix > Incidental Mutation

Incidental Mutation 'R1867:Usp34'

208859

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R1867 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23361593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 462 (Y462H)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000137823
AA Change: Y481H

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: Y481H

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000180046
AA Change: Y462H

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: Y462H

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	T	5: 66,000,217	M1K	probably null	Het
Abca4	T	A	3: 122,105,361	I664N	probably damaging	Het
Acin1	T	C	14: 54,644,261	D335G	probably damaging	Het
Acoxl	A	G	2: 127,877,787	Y156C	probably damaging	Het
Adamts20	A	G	15: 94,338,459	F844L	probably benign	Het
Ago1	A	G	4: 126,441,236	Y398H	probably damaging	Het
Aldob	A	G	4: 49,543,835	V49A	possibly damaging	Het
Arhgap18	A	G	10: 26,846,030	E71G	probably damaging	Het
Asb12	G	T	X: 95,470,344	H307N	probably damaging	Het
Atp2b1	T	C	10: 98,996,888	V417A	probably damaging	Het
AY358078	T	C	14: 51,800,047	M1T	probably null	Het
BC117090	T	G	16: 36,321,786	D76A	possibly damaging	Het
Bcl2l15	A	G	3: 103,838,598		probably null	Het
Brpf3	A	G	17: 28,807,368	M472V	probably benign	Het
Bsn	A	G	9: 108,106,719	S3379P	unknown	Het
Cap2	T	C	13: 46,640,079	V333A	probably damaging	Het
Ccdc173	A	T	2: 69,781,837		probably null	Het
Cd207	T	A	6: 83,675,653	D165V	probably damaging	Het
Cmtr1	A	G	17: 29,674,174	T496A	probably benign	Het
Col14a1	T	A	15: 55,447,462		probably benign	Het
Cstb	A	G	10: 78,427,439	*99W	probably null	Het
Ddx11	G	A	17: 66,135,939		probably null	Het
Dip2c	T	C	13: 9,621,949	M990T	possibly damaging	Het
Epc2	A	G	2: 49,532,105	Y337C	probably damaging	Het
Fmn1	A	G	2: 113,709,438	E1326G	probably damaging	Het
Focad	A	T	4: 88,178,089	D236V	probably damaging	Het
Fsd1	G	A	17: 55,991,254	S193N	probably benign	Het
Gm4922	T	A	10: 18,784,463	R170S	possibly damaging	Het
Gm5129	T	C	5: 29,735,656		probably benign	Het
Gucy2d	T	A	7: 98,454,061	L504H	probably damaging	Het
Hspbap1	A	T	16: 35,801,564	Y93F	possibly damaging	Het
Iars2	A	T	1: 185,318,568	D441E	probably benign	Het
Il1rap	A	T	16: 26,722,926	H639L	probably damaging	Het
Inhbc	A	T	10: 127,357,547	V200E	probably benign	Het
Ints8	C	A	4: 11,241,684	C253F	probably damaging	Het
Intu	G	T	3: 40,664,335	G257V	probably damaging	Het
Kif23	C	A	9: 61,918,961	A929S	possibly damaging	Het
Kmt2b	A	T	7: 30,574,658	V2207E	possibly damaging	Het
Ksr2	A	C	5: 117,505,529	E121A	probably benign	Het
Lce1b	A	G	3: 92,656,011	S72P	unknown	Het
Lpl	TGG	TG	8: 68,896,602		probably null	Het
Mcmdc2	T	C	1: 9,930,805	V435A	probably damaging	Het
Mecom	A	G	3: 30,509,428		probably null	Het
Mier2	A	G	10: 79,548,830	V150A	probably damaging	Het
Mmp16	A	T	4: 18,116,013	D539V	probably benign	Het
Mpp1	A	G	X: 75,125,369		probably null	Het
Mpp2	C	T	11: 102,064,667	E86K	probably benign	Het
Mtor	T	A	4: 148,454,632	F195L	probably damaging	Het
Myo3a	T	C	2: 22,399,846	I663T	probably benign	Het
Nlrp5	G	A	7: 23,423,982	G756E	possibly damaging	Het
Nudt18	T	C	14: 70,579,895	L255P	probably damaging	Het
Nup62	T	A	7: 44,829,048	S162R	possibly damaging	Het
Olfr1097	A	G	2: 86,890,612	S188P	probably damaging	Het
Olfr659	T	A	7: 104,671,317	I205N	possibly damaging	Het
Olfr798	A	T	10: 129,625,752	I103K	probably damaging	Het
Olfr835	G	A	9: 19,035,266	A48T	probably benign	Het
Oosp2	C	T	19: 11,649,595		probably null	Het
Pan2	A	G	10: 128,313,181	D506G	probably damaging	Het
Pcdh9	G	A	14: 93,888,035	S233L	probably damaging	Het
Pcdhgc5	T	G	18: 37,821,418	S582A	possibly damaging	Het
Pdik1l	T	C	4: 134,278,911	D70G	probably damaging	Het
Peg12	T	C	7: 62,463,668	H227R	probably benign	Het
Pms1	C	T	1: 53,189,387	V901I	probably benign	Het
Pnisr	C	T	4: 21,874,086		probably benign	Het
Pole	A	G	5: 110,334,197	E135G	probably benign	Het
Ppp6r2	C	A	15: 89,281,938	A715E	probably benign	Het
Prickle4	T	G	17: 47,690,119	H174P	possibly damaging	Het
Prl2a1	T	C	13: 27,804,940	L16P	probably damaging	Het
Prss32	C	T	17: 23,853,894	T33M	probably benign	Het
Psmd13	C	T	7: 140,883,517	T38I	probably damaging	Het
Rai14	C	A	15: 10,633,228	Q25H	probably damaging	Het
Rbbp6	T	C	7: 122,997,029	V598A	probably damaging	Het
Rbm34	C	A	8: 126,970,881	A27S	probably benign	Het
Rbm4b	A	G	19: 4,762,303	T247A	probably benign	Het
Riiad1	G	A	3: 94,472,869	P40S	possibly damaging	Het
Sema4f	T	C	6: 82,917,843	D457G	possibly damaging	Het
Sema6c	A	T	3: 95,170,788	I492F	probably damaging	Het
Serpina3a	A	T	12: 104,118,627	I94L	probably benign	Het
Skida1	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	2: 18,046,344		probably benign	Het
Slc38a1	G	A	15: 96,587,135	T221M	probably damaging	Het
Slc6a17	T	A	3: 107,472,176	M559L	probably damaging	Het
Sntg2	T	C	12: 30,236,651	N315D	probably benign	Het
Snx10	T	A	6: 51,575,910	V11E	probably damaging	Het
Spta1	A	G	1: 174,219,839	E1683G	probably benign	Het
Ssc5d	A	T	7: 4,928,507	R238W	probably damaging	Het
Ssh1	A	T	5: 113,943,451	F617L	probably damaging	Het
Taf1	T	G	X: 101,562,957	M1254R	probably damaging	Het
Tcirg1	A	G	19: 3,898,835	L450P	probably damaging	Het
Ticam1	C	A	17: 56,271,718	A126S	probably benign	Het
Tnxb	T	A	17: 34,671,847	V388E	probably damaging	Het
Tomm5	A	G	4: 45,107,939	L32P	probably damaging	Het
Ubr5	A	T	15: 38,041,846	S169T	probably benign	Het
Usp28	T	G	9: 49,009,194	D240E	probably benign	Het
Utp14b	C	A	1: 78,665,431	Q349K	probably damaging	Het
Utp20	G	T	10: 88,749,443	D2586E	probably benign	Het
Vmn1r173	A	G	7: 23,703,235	I298M	unknown	Het
Vmn1r37	T	A	6: 66,731,477	I29K	probably benign	Het
Vmn2r23	G	A	6: 123,702,915	G32D	probably damaging	Het
Xpo7	A	T	14: 70,693,991	F296I	probably damaging	Het
Zfhx4	A	G	3: 5,412,714	E3463G	probably damaging	Het
Zfp455	G	T	13: 67,207,445	R194L	probably benign	Het
Zfp663	T	C	2: 165,352,731	T523A	possibly damaging	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCAGCTCTTGAACCAGGTG -3'
(R):5'- CAGTCTTTATTCAACAGAGTTGTGGG -3'

Sequencing Primer
(F):5'- TCATACTGAACAGGTAAGACATTGAG -3'
(R):5'- CAACAGAGTTGTGGGGTTTAATTTAC -3'

Posted On

2014-06-30