Incidental Mutation 'R0117:Bbs10'
ID20886
Institutional Source Beutler Lab
Gene Symbol Bbs10
Ensembl Gene ENSMUSG00000035759
Gene NameBardet-Biedl syndrome 10 (human)
Synonyms
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0117 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location111298679-111301727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111299333 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 102 (D102E)
Ref Sequence ENSEMBL: ENSMUSP00000049387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040454] [ENSMUST00000105275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040454
AA Change: D102E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049387
Gene: ENSMUSG00000035759
AA Change: D102E

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 17 103 3.6e-15 PFAM
Pfam:Cpn60_TCP1 139 427 1.1e-7 PFAM
SCOP:d1a6da1 567 695 3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105275
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219990
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by progressive retinal degeneration, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene is likely not a ciliary protein but rather has distant sequence homology to type II chaperonins. As a molecular chaperone, this protein may affect the folding or stability of other ciliary or basal body proteins. Inhibition of this protein's expression impairs ciliogenesis in preadipocytes. Mutations in this gene cause Bardet-Biedl syndrome type 10. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop obesity, hyperleptinemia, retinal degeneration, structural defects in renal glomeruli, microalbuminuria, polyuria, increased circulating antidiuretic hormone levels, and vacuolated renal epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Bbs10
AlleleSourceChrCoordTypePredicted EffectPPH Score
chalky UTSW 10 111299761 missense probably damaging 1.00
wampum UTSW 10 111300013 missense probably damaging 1.00
R0097:Bbs10 UTSW 10 111298844 missense probably damaging 1.00
R0189:Bbs10 UTSW 10 111301065 missense probably damaging 1.00
R0373:Bbs10 UTSW 10 111300052 missense probably damaging 1.00
R0761:Bbs10 UTSW 10 111299383 missense probably damaging 1.00
R1319:Bbs10 UTSW 10 111298874 missense probably damaging 1.00
R1986:Bbs10 UTSW 10 111299257 missense probably damaging 1.00
R2015:Bbs10 UTSW 10 111300855 nonsense probably null
R2361:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3716:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3717:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4407:Bbs10 UTSW 10 111299859 missense probably benign 0.00
R4583:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4607:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4607:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4608:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4608:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4609:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4646:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4647:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4648:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4730:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4822:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4832:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R5056:Bbs10 UTSW 10 111300540 missense probably benign 0.00
R6285:Bbs10 UTSW 10 111299761 missense probably damaging 1.00
R6604:Bbs10 UTSW 10 111301104 missense possibly damaging 0.51
R7120:Bbs10 UTSW 10 111299449 missense possibly damaging 0.74
R7174:Bbs10 UTSW 10 111300767 nonsense probably null
R7376:Bbs10 UTSW 10 111299250 missense probably benign 0.08
R7701:Bbs10 UTSW 10 111300013 missense probably damaging 1.00
R8146:Bbs10 UTSW 10 111300535 missense probably benign 0.05
Z1176:Bbs10 UTSW 10 111298908 critical splice donor site probably null
Z1176:Bbs10 UTSW 10 111299657 missense probably benign 0.26
Z1176:Bbs10 UTSW 10 111301124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTAGACATCAGAGAGCTGCCC -3'
(R):5'- GACAGGTAGTGCCTGCTTAAACTCC -3'

Sequencing Primer
(F):5'- AGGACAATCTGTGTGCCTTATAGC -3'
(R):5'- TGCTTAAACTCCGGTCTACAATAC -3'
Posted On2013-04-11