Incidental Mutation 'R1867:Cap2'
ID 208865
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R1867 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46793555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 333 (V333A)
Ref Sequence ENSEMBL: ENSMUSP00000153125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably damaging
Transcript: ENSMUST00000021802
AA Change: V388A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: V388A

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119341
AA Change: V276A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373
AA Change: V276A

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000126687
AA Change: V7A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225444
Predicted Effect probably damaging
Transcript: ENSMUST00000225824
AA Change: V333A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,157,560 (GRCm39) M1K probably null Het
Abca4 T A 3: 121,899,010 (GRCm39) I664N probably damaging Het
Acin1 T C 14: 54,881,718 (GRCm39) D335G probably damaging Het
Acoxl A G 2: 127,719,707 (GRCm39) Y156C probably damaging Het
Adamts20 A G 15: 94,236,340 (GRCm39) F844L probably benign Het
Ago1 A G 4: 126,335,029 (GRCm39) Y398H probably damaging Het
Aldob A G 4: 49,543,835 (GRCm39) V49A possibly damaging Het
Arhgap18 A G 10: 26,722,026 (GRCm39) E71G probably damaging Het
Asb12 G T X: 94,513,950 (GRCm39) H307N probably damaging Het
Atp2b1 T C 10: 98,832,750 (GRCm39) V417A probably damaging Het
AY358078 T C 14: 52,037,504 (GRCm39) M1T probably null Het
Bcl2l15 A G 3: 103,745,914 (GRCm39) probably null Het
Brpf3 A G 17: 29,026,342 (GRCm39) M472V probably benign Het
Bsn A G 9: 107,983,918 (GRCm39) S3379P unknown Het
Cd207 T A 6: 83,652,635 (GRCm39) D165V probably damaging Het
Cfap210 A T 2: 69,612,181 (GRCm39) probably null Het
Cmtr1 A G 17: 29,893,148 (GRCm39) T496A probably benign Het
Col14a1 T A 15: 55,310,858 (GRCm39) probably benign Het
Cstb A G 10: 78,263,273 (GRCm39) *99W probably null Het
Cstdc6 T G 16: 36,142,148 (GRCm39) D76A possibly damaging Het
Ddx11 G A 17: 66,442,934 (GRCm39) probably null Het
Dip2c T C 13: 9,671,985 (GRCm39) M990T possibly damaging Het
Epc2 A G 2: 49,422,117 (GRCm39) Y337C probably damaging Het
Fmn1 A G 2: 113,539,783 (GRCm39) E1326G probably damaging Het
Focad A T 4: 88,096,326 (GRCm39) D236V probably damaging Het
Fsd1 G A 17: 56,298,254 (GRCm39) S193N probably benign Het
Gm4922 T A 10: 18,660,211 (GRCm39) R170S possibly damaging Het
Gm5129 T C 5: 29,940,654 (GRCm39) probably benign Het
Gucy2d T A 7: 98,103,268 (GRCm39) L504H probably damaging Het
Hspbap1 A T 16: 35,621,934 (GRCm39) Y93F possibly damaging Het
Iars2 A T 1: 185,050,765 (GRCm39) D441E probably benign Het
Il1rap A T 16: 26,541,676 (GRCm39) H639L probably damaging Het
Inhbc A T 10: 127,193,416 (GRCm39) V200E probably benign Het
Ints8 C A 4: 11,241,684 (GRCm39) C253F probably damaging Het
Intu G T 3: 40,618,765 (GRCm39) G257V probably damaging Het
Kif23 C A 9: 61,826,243 (GRCm39) A929S possibly damaging Het
Kmt2b A T 7: 30,274,083 (GRCm39) V2207E possibly damaging Het
Ksr2 A C 5: 117,643,594 (GRCm39) E121A probably benign Het
Lce1b A G 3: 92,563,318 (GRCm39) S72P unknown Het
Lpl TGG TG 8: 69,349,254 (GRCm39) probably null Het
Mcmdc2 T C 1: 10,001,030 (GRCm39) V435A probably damaging Het
Mecom A G 3: 30,563,577 (GRCm39) probably null Het
Mier2 A G 10: 79,384,664 (GRCm39) V150A probably damaging Het
Mmp16 A T 4: 18,116,013 (GRCm39) D539V probably benign Het
Mpp1 A G X: 74,168,975 (GRCm39) probably null Het
Mpp2 C T 11: 101,955,493 (GRCm39) E86K probably benign Het
Mtor T A 4: 148,539,089 (GRCm39) F195L probably damaging Het
Myo3a T C 2: 22,404,657 (GRCm39) I663T probably benign Het
Nlrp5 G A 7: 23,123,407 (GRCm39) G756E possibly damaging Het
Nudt18 T C 14: 70,817,335 (GRCm39) L255P probably damaging Het
Nup62 T A 7: 44,478,472 (GRCm39) S162R possibly damaging Het
Oosp2 C T 19: 11,626,959 (GRCm39) probably null Het
Or52n20 T A 7: 104,320,524 (GRCm39) I205N possibly damaging Het
Or6c66 A T 10: 129,461,621 (GRCm39) I103K probably damaging Het
Or7g20 G A 9: 18,946,562 (GRCm39) A48T probably benign Het
Or8h7 A G 2: 86,720,956 (GRCm39) S188P probably damaging Het
Pan2 A G 10: 128,149,050 (GRCm39) D506G probably damaging Het
Pcdh9 G A 14: 94,125,471 (GRCm39) S233L probably damaging Het
Pcdhgc5 T G 18: 37,954,471 (GRCm39) S582A possibly damaging Het
Pdik1l T C 4: 134,006,222 (GRCm39) D70G probably damaging Het
Peg12 T C 7: 62,113,416 (GRCm39) H227R probably benign Het
Pms1 C T 1: 53,228,546 (GRCm39) V901I probably benign Het
Pnisr C T 4: 21,874,086 (GRCm39) probably benign Het
Pole A G 5: 110,482,063 (GRCm39) E135G probably benign Het
Ppp6r2 C A 15: 89,166,141 (GRCm39) A715E probably benign Het
Prickle4 T G 17: 48,001,044 (GRCm39) H174P possibly damaging Het
Prl2a1 T C 13: 27,988,923 (GRCm39) L16P probably damaging Het
Prss32 C T 17: 24,072,868 (GRCm39) T33M probably benign Het
Psmd13 C T 7: 140,463,430 (GRCm39) T38I probably damaging Het
Rai14 C A 15: 10,633,314 (GRCm39) Q25H probably damaging Het
Rbbp6 T C 7: 122,596,252 (GRCm39) V598A probably damaging Het
Rbm34 C A 8: 127,697,631 (GRCm39) A27S probably benign Het
Rbm4b A G 19: 4,812,331 (GRCm39) T247A probably benign Het
Riiad1 G A 3: 94,380,176 (GRCm39) P40S possibly damaging Het
Sema4f T C 6: 82,894,824 (GRCm39) D457G possibly damaging Het
Sema6c A T 3: 95,078,099 (GRCm39) I492F probably damaging Het
Serpina3a A T 12: 104,084,886 (GRCm39) I94L probably benign Het
Skida1 TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 2: 18,051,155 (GRCm39) probably benign Het
Slc38a1 G A 15: 96,485,016 (GRCm39) T221M probably damaging Het
Slc6a17 T A 3: 107,379,492 (GRCm39) M559L probably damaging Het
Sntg2 T C 12: 30,286,650 (GRCm39) N315D probably benign Het
Snx10 T A 6: 51,552,890 (GRCm39) V11E probably damaging Het
Spta1 A G 1: 174,047,405 (GRCm39) E1683G probably benign Het
Ssc5d A T 7: 4,931,506 (GRCm39) R238W probably damaging Het
Ssh1 A T 5: 114,081,512 (GRCm39) F617L probably damaging Het
Taf1 T G X: 100,606,563 (GRCm39) M1254R probably damaging Het
Tcirg1 A G 19: 3,948,835 (GRCm39) L450P probably damaging Het
Ticam1 C A 17: 56,578,718 (GRCm39) A126S probably benign Het
Tnxb T A 17: 34,890,821 (GRCm39) V388E probably damaging Het
Tomm5 A G 4: 45,107,939 (GRCm39) L32P probably damaging Het
Ubr5 A T 15: 38,042,090 (GRCm39) S169T probably benign Het
Usp28 T G 9: 48,920,494 (GRCm39) D240E probably benign Het
Usp34 T C 11: 23,311,593 (GRCm39) Y462H possibly damaging Het
Utp14b C A 1: 78,643,148 (GRCm39) Q349K probably damaging Het
Utp20 G T 10: 88,585,305 (GRCm39) D2586E probably benign Het
Vmn1r173 A G 7: 23,402,660 (GRCm39) I298M unknown Het
Vmn1r37 T A 6: 66,708,461 (GRCm39) I29K probably benign Het
Vmn2r23 G A 6: 123,679,874 (GRCm39) G32D probably damaging Het
Xpo7 A T 14: 70,931,431 (GRCm39) F296I probably damaging Het
Zfhx4 A G 3: 5,477,774 (GRCm39) E3463G probably damaging Het
Zfp455 G T 13: 67,355,509 (GRCm39) R194L probably benign Het
Zfp663 T C 2: 165,194,651 (GRCm39) T523A possibly damaging Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R0712:Cap2 UTSW 13 46,768,837 (GRCm39) splice site probably null
R1489:Cap2 UTSW 13 46,763,111 (GRCm39) missense probably damaging 1.00
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1668:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4748:Cap2 UTSW 13 46,793,302 (GRCm39) missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4876:Cap2 UTSW 13 46,684,497 (GRCm39) start codon destroyed probably null
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5320:Cap2 UTSW 13 46,801,840 (GRCm39) makesense probably null
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R5670:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R7889:Cap2 UTSW 13 46,800,051 (GRCm39) missense probably damaging 0.99
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8205:Cap2 UTSW 13 46,768,739 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGAAACAAGTGGCTTAC -3'
(R):5'- GACTAAAGACTGGGCTTCCC -3'

Sequencing Primer
(F):5'- GCTGAAACAAGTGGCTTACATTTTC -3'
(R):5'- TTCCCCAGAGAGGCGATGATG -3'
Posted On 2014-06-30