Incidental Mutation 'R1867:Pcdh9'
ID208871
Institutional Source Beutler Lab
Gene Symbol Pcdh9
Ensembl Gene ENSMUSG00000055421
Gene Nameprotocadherin 9
SynonymsC630029H24Rik, A730003J17Rik, C530050I23Rik, LOC382930, 1500001L12Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R1867 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location93013410-93890679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93888035 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 233 (S233L)
Ref Sequence ENSEMBL: ENSMUSP00000141602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068992] [ENSMUST00000192221] [ENSMUST00000193901] [ENSMUST00000194056] [ENSMUST00000195376] [ENSMUST00000195826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068992
AA Change: S233L

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070935
Gene: ENSMUSG00000055421
AA Change: S233L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192221
AA Change: S110L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142260
Gene: ENSMUSG00000055421
AA Change: S110L

DomainStartEndE-ValueType
CA 41 127 1.01e-20 SMART
CA 151 233 2.34e-25 SMART
CA 263 344 2.14e-19 SMART
CA 368 447 4.27e-28 SMART
CA 471 550 2.45e-28 SMART
CA 577 659 1.01e-6 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 735 760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192817
Predicted Effect probably damaging
Transcript: ENSMUST00000193901
AA Change: S233L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141759
Gene: ENSMUSG00000055421
AA Change: S233L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194056
AA Change: S233L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141602
Gene: ENSMUSG00000055421
AA Change: S233L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194129
Predicted Effect probably benign
Transcript: ENSMUST00000195376
AA Change: S233L

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142224
Gene: ENSMUSG00000055421
AA Change: S233L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195826
AA Change: S233L

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141396
Gene: ENSMUSG00000055421
AA Change: S233L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protocadherin family, and cadherin superfamily, of transmembrane proteins containing cadherin domains. These proteins mediate cell adhesion in neural tissues in the presence of calcium. The encoded protein may be involved in signaling at neuronal synaptic junctions. Sharing a characteristic with other protocadherin genes, this gene has a notably large exon that encodes multiple cadherin domains and a transmembrane region. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired long-term social and bject recognition and sensorimotor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
Abca4 T A 3: 122,105,361 I664N probably damaging Het
Acin1 T C 14: 54,644,261 D335G probably damaging Het
Acoxl A G 2: 127,877,787 Y156C probably damaging Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Ago1 A G 4: 126,441,236 Y398H probably damaging Het
Aldob A G 4: 49,543,835 V49A possibly damaging Het
Arhgap18 A G 10: 26,846,030 E71G probably damaging Het
Asb12 G T X: 95,470,344 H307N probably damaging Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
AY358078 T C 14: 51,800,047 M1T probably null Het
BC117090 T G 16: 36,321,786 D76A possibly damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Brpf3 A G 17: 28,807,368 M472V probably benign Het
Bsn A G 9: 108,106,719 S3379P unknown Het
Cap2 T C 13: 46,640,079 V333A probably damaging Het
Ccdc173 A T 2: 69,781,837 probably null Het
Cd207 T A 6: 83,675,653 D165V probably damaging Het
Cmtr1 A G 17: 29,674,174 T496A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Cstb A G 10: 78,427,439 *99W probably null Het
Ddx11 G A 17: 66,135,939 probably null Het
Dip2c T C 13: 9,621,949 M990T possibly damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Fmn1 A G 2: 113,709,438 E1326G probably damaging Het
Focad A T 4: 88,178,089 D236V probably damaging Het
Fsd1 G A 17: 55,991,254 S193N probably benign Het
Gm4922 T A 10: 18,784,463 R170S possibly damaging Het
Gm5129 T C 5: 29,735,656 probably benign Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Hspbap1 A T 16: 35,801,564 Y93F possibly damaging Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Il1rap A T 16: 26,722,926 H639L probably damaging Het
Inhbc A T 10: 127,357,547 V200E probably benign Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Kif23 C A 9: 61,918,961 A929S possibly damaging Het
Kmt2b A T 7: 30,574,658 V2207E possibly damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lpl TGG TG 8: 68,896,602 probably null Het
Mcmdc2 T C 1: 9,930,805 V435A probably damaging Het
Mecom A G 3: 30,509,428 probably null Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mmp16 A T 4: 18,116,013 D539V probably benign Het
Mpp1 A G X: 75,125,369 probably null Het
Mpp2 C T 11: 102,064,667 E86K probably benign Het
Mtor T A 4: 148,454,632 F195L probably damaging Het
Myo3a T C 2: 22,399,846 I663T probably benign Het
Nlrp5 G A 7: 23,423,982 G756E possibly damaging Het
Nudt18 T C 14: 70,579,895 L255P probably damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr659 T A 7: 104,671,317 I205N possibly damaging Het
Olfr798 A T 10: 129,625,752 I103K probably damaging Het
Olfr835 G A 9: 19,035,266 A48T probably benign Het
Oosp2 C T 19: 11,649,595 probably null Het
Pan2 A G 10: 128,313,181 D506G probably damaging Het
Pcdhgc5 T G 18: 37,821,418 S582A possibly damaging Het
Pdik1l T C 4: 134,278,911 D70G probably damaging Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Pms1 C T 1: 53,189,387 V901I probably benign Het
Pnisr C T 4: 21,874,086 probably benign Het
Pole A G 5: 110,334,197 E135G probably benign Het
Ppp6r2 C A 15: 89,281,938 A715E probably benign Het
Prickle4 T G 17: 47,690,119 H174P possibly damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Prss32 C T 17: 23,853,894 T33M probably benign Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rbbp6 T C 7: 122,997,029 V598A probably damaging Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rbm4b A G 19: 4,762,303 T247A probably benign Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Sema4f T C 6: 82,917,843 D457G possibly damaging Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Serpina3a A T 12: 104,118,627 I94L probably benign Het
Skida1 TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 2: 18,046,344 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Sntg2 T C 12: 30,236,651 N315D probably benign Het
Snx10 T A 6: 51,575,910 V11E probably damaging Het
Spta1 A G 1: 174,219,839 E1683G probably benign Het
Ssc5d A T 7: 4,928,507 R238W probably damaging Het
Ssh1 A T 5: 113,943,451 F617L probably damaging Het
Taf1 T G X: 101,562,957 M1254R probably damaging Het
Tcirg1 A G 19: 3,898,835 L450P probably damaging Het
Ticam1 C A 17: 56,271,718 A126S probably benign Het
Tnxb T A 17: 34,671,847 V388E probably damaging Het
Tomm5 A G 4: 45,107,939 L32P probably damaging Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp28 T G 9: 49,009,194 D240E probably benign Het
Usp34 T C 11: 23,361,593 Y462H possibly damaging Het
Utp14b C A 1: 78,665,431 Q349K probably damaging Het
Utp20 G T 10: 88,749,443 D2586E probably benign Het
Vmn1r173 A G 7: 23,703,235 I298M unknown Het
Vmn1r37 T A 6: 66,731,477 I29K probably benign Het
Vmn2r23 G A 6: 123,702,915 G32D probably damaging Het
Xpo7 A T 14: 70,693,991 F296I probably damaging Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp455 G T 13: 67,207,445 R194L probably benign Het
Zfp663 T C 2: 165,352,731 T523A possibly damaging Het
Other mutations in Pcdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Pcdh9 APN 14 93326694 missense probably damaging 1.00
IGL02183:Pcdh9 APN 14 93886284 missense probably benign 0.01
IGL02244:Pcdh9 APN 14 93326768 missense probably damaging 1.00
IGL02571:Pcdh9 APN 14 93560587 splice site probably benign
IGL03018:Pcdh9 APN 14 93015576 missense probably null
I1329:Pcdh9 UTSW 14 93886209 missense probably benign 0.00
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0477:Pcdh9 UTSW 14 93887678 missense probably damaging 0.99
R0499:Pcdh9 UTSW 14 93886235 missense probably damaging 1.00
R0787:Pcdh9 UTSW 14 93886757 missense possibly damaging 0.88
R1205:Pcdh9 UTSW 14 93886065 missense probably benign 0.01
R1616:Pcdh9 UTSW 14 93886969 nonsense probably null
R1620:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1622:Pcdh9 UTSW 14 93885875 missense probably benign 0.03
R1708:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1721:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1753:Pcdh9 UTSW 14 93887225 missense probably benign 0.33
R1799:Pcdh9 UTSW 14 93888671 missense probably benign 0.36
R1987:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1988:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R2444:Pcdh9 UTSW 14 93886791 missense probably benign 0.10
R3895:Pcdh9 UTSW 14 93887538 missense probably damaging 1.00
R3926:Pcdh9 UTSW 14 93886810 nonsense probably null
R4166:Pcdh9 UTSW 14 93887520 nonsense probably null
R4429:Pcdh9 UTSW 14 93887384 missense probably damaging 0.96
R4589:Pcdh9 UTSW 14 93888192 missense probably damaging 1.00
R4604:Pcdh9 UTSW 14 93887180 missense probably damaging 1.00
R4607:Pcdh9 UTSW 14 93015573 missense probably benign 0.08
R4621:Pcdh9 UTSW 14 93887643 missense probably benign 0.12
R4624:Pcdh9 UTSW 14 93886409 missense probably damaging 1.00
R4712:Pcdh9 UTSW 14 93888631 missense probably damaging 1.00
R4788:Pcdh9 UTSW 14 93887415 missense probably damaging 1.00
R4831:Pcdh9 UTSW 14 93887941 missense probably damaging 1.00
R4883:Pcdh9 UTSW 14 93888728 missense possibly damaging 0.83
R5034:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
R5175:Pcdh9 UTSW 14 93888443 missense probably damaging 1.00
R5637:Pcdh9 UTSW 14 93885762 missense possibly damaging 0.91
R5743:Pcdh9 UTSW 14 93886724 missense probably damaging 1.00
R5753:Pcdh9 UTSW 14 93888161 missense probably damaging 1.00
R5770:Pcdh9 UTSW 14 93886943 missense probably damaging 1.00
R5900:Pcdh9 UTSW 14 93326720 missense probably damaging 0.98
R5986:Pcdh9 UTSW 14 93887048 missense probably damaging 1.00
R6052:Pcdh9 UTSW 14 93885846 missense probably benign 0.40
R6113:Pcdh9 UTSW 14 93887108 missense probably damaging 1.00
R6223:Pcdh9 UTSW 14 93015733 missense probably benign 0.18
R6415:Pcdh9 UTSW 14 93015842 missense possibly damaging 0.83
R6435:Pcdh9 UTSW 14 93887844 missense probably benign 0.01
R7064:Pcdh9 UTSW 14 93886149 missense probably damaging 1.00
R7143:Pcdh9 UTSW 14 93888272 missense probably damaging 0.99
R7219:Pcdh9 UTSW 14 93015780 missense possibly damaging 0.87
R7262:Pcdh9 UTSW 14 93015705 missense probably benign 0.01
R7354:Pcdh9 UTSW 14 93888270 missense probably benign 0.28
R7369:Pcdh9 UTSW 14 93886367 missense possibly damaging 0.67
R7427:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7428:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7780:Pcdh9 UTSW 14 93886551 missense possibly damaging 0.91
X0012:Pcdh9 UTSW 14 93886644 missense possibly damaging 0.71
X0067:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCGGATTTCAGCATTACTGC -3'
(R):5'- ACTTTGATCAACAGCCGCTTTC -3'

Sequencing Primer
(F):5'- CCTATGTCTGCATCAGTGGCATG -3'
(R):5'- TGACACGGGCTTCAATGG -3'
Posted On2014-06-30