Incidental Mutation 'R0117:Mpp3'
ID20888
Institutional Source Beutler Lab
Gene Symbol Mpp3
Ensembl Gene ENSMUSG00000052373
Gene Namemembrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
SynonymsDlgh3
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0117 (G1)
Quality Score173
Status Validated (trace)
Chromosome11
Chromosomal Location101999652-102028461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102000573 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 580 (P580S)
Ref Sequence ENSEMBL: ENSMUSP00000102786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062801] [ENSMUST00000100400] [ENSMUST00000107168]
Predicted Effect probably damaging
Transcript: ENSMUST00000062801
AA Change: P580S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055469
Gene: ENSMUSG00000052373
AA Change: P580S

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100400
AA Change: P580S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097969
Gene: ENSMUSG00000052373
AA Change: P580S

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107168
AA Change: P580S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102786
Gene: ENSMUSG00000052373
AA Change: P580S

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132094
Meta Mutation Damage Score 0.9506 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Mpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Mpp3 APN 11 102002103 missense possibly damaging 0.76
IGL01337:Mpp3 APN 11 102000585 missense probably benign
IGL01393:Mpp3 APN 11 102025478 missense probably damaging 0.99
IGL01544:Mpp3 APN 11 102018659 missense possibly damaging 0.91
IGL02152:Mpp3 APN 11 102025390 nonsense probably null
IGL02441:Mpp3 APN 11 102009675 missense probably benign 0.00
IGL02656:Mpp3 APN 11 102008601 missense probably benign
R0013:Mpp3 UTSW 11 102005425 missense probably benign 0.27
R0564:Mpp3 UTSW 11 102005347 missense possibly damaging 0.87
R1372:Mpp3 UTSW 11 102000575 missense probably damaging 0.96
R1531:Mpp3 UTSW 11 102008649 missense probably benign
R1639:Mpp3 UTSW 11 102023442 missense probably damaging 1.00
R1720:Mpp3 UTSW 11 102025756 start codon destroyed possibly damaging 0.79
R1968:Mpp3 UTSW 11 102018552 intron probably benign
R2064:Mpp3 UTSW 11 102000690 missense probably benign 0.01
R2363:Mpp3 UTSW 11 102020486 missense probably damaging 1.00
R3775:Mpp3 UTSW 11 102023367 nonsense probably null
R3776:Mpp3 UTSW 11 102023367 nonsense probably null
R4208:Mpp3 UTSW 11 102000600 missense probably benign
R4287:Mpp3 UTSW 11 102023463 missense probably damaging 1.00
R4327:Mpp3 UTSW 11 102023511 intron probably benign
R4329:Mpp3 UTSW 11 102023511 intron probably benign
R4367:Mpp3 UTSW 11 102023420 missense probably benign 0.01
R4856:Mpp3 UTSW 11 102025136 missense probably benign
R4886:Mpp3 UTSW 11 102025136 missense probably benign
R4904:Mpp3 UTSW 11 102000587 missense probably benign 0.01
R4946:Mpp3 UTSW 11 102005022 missense probably benign 0.01
R5405:Mpp3 UTSW 11 102010221 missense probably benign
R5935:Mpp3 UTSW 11 102025415 missense probably damaging 1.00
R6020:Mpp3 UTSW 11 102018539 intron probably benign
R6056:Mpp3 UTSW 11 102011689 splice site probably null
R6151:Mpp3 UTSW 11 102008566 missense probably benign 0.11
R6677:Mpp3 UTSW 11 102008618 missense probably benign
R6784:Mpp3 UTSW 11 102002148 critical splice acceptor site probably null
R6855:Mpp3 UTSW 11 102013325 missense probably benign 0.09
R7227:Mpp3 UTSW 11 102005078 missense possibly damaging 0.90
R7635:Mpp3 UTSW 11 102025383 missense probably damaging 0.97
R7974:Mpp3 UTSW 11 102008354 critical splice donor site probably null
R8330:Mpp3 UTSW 11 102008627 missense probably benign 0.20
R8331:Mpp3 UTSW 11 102011715 splice site probably null
Z1176:Mpp3 UTSW 11 102008356 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACACGCTATTCTGTGGACTGCCC -3'
(R):5'- TGGCTCTCGGCTCATAGATCTTTGG -3'

Sequencing Primer
(F):5'- TTCAGCTCCGCTCGTGAAG -3'
(R):5'- ACTCTCGTGTTCACAGTTAAGG -3'
Posted On2013-04-11