Incidental Mutation 'R0117:Serpina1c'
ID20889
Institutional Source Beutler Lab
Gene Symbol Serpina1c
Ensembl Gene ENSMUSG00000079015
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1C
SynonymsPI3, PI6, Spi1-6, Spi1-3
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0117 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103894926-103904887 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to G at 103895012 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 414 (*414C)
Ref Sequence ENSEMBL: ENSMUSP00000073695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074051]
Predicted Effect probably null
Transcript: ENSMUST00000074051
AA Change: *414C
SMART Domains Protein: ENSMUSP00000073695
Gene: ENSMUSG00000079015
AA Change: *414C

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
SERPIN 53 410 5.23e-201 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130054
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Serpina1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01905:Serpina1c APN 12 103897059 missense possibly damaging 0.84
IGL02220:Serpina1c APN 12 103896079 missense probably damaging 1.00
IGL02250:Serpina1c APN 12 103897228 missense probably benign 0.42
R0077:Serpina1c UTSW 12 103896091 missense probably benign 0.00
R1843:Serpina1c UTSW 12 103895023 missense probably benign 0.28
R2196:Serpina1c UTSW 12 103896111 missense probably damaging 0.99
R4261:Serpina1c UTSW 12 103897080 missense probably benign 0.03
R4486:Serpina1c UTSW 12 103897000 intron probably null
R4572:Serpina1c UTSW 12 103898708 intron probably benign
R4910:Serpina1c UTSW 12 103895032 missense probably benign 0.05
R5036:Serpina1c UTSW 12 103898826 missense probably damaging 0.99
R6209:Serpina1c UTSW 12 103897170 missense probably damaging 1.00
R7533:Serpina1c UTSW 12 103897307 missense probably damaging 1.00
R7618:Serpina1c UTSW 12 103898770 missense probably damaging 1.00
X0027:Serpina1c UTSW 12 103897072 missense probably benign 0.00
X0064:Serpina1c UTSW 12 103896003 critical splice donor site probably null
Z1176:Serpina1c UTSW 12 103897143 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CAACCTATTTGCATGGCTGGAGGAG -3'
(R):5'- ATGGAAATCACCCTACCTGCAACTG -3'

Sequencing Primer
(F):5'- TCAAGACATACTATGATCTCAAGTCC -3'
(R):5'- TGCATAAGGCTGTGCTGACC -3'
Posted On2013-04-11