Incidental Mutation 'R0117:Htr2a'
ID20893
Institutional Source Beutler Lab
Gene Symbol Htr2a
Ensembl Gene ENSMUSG00000034997
Gene Name5-hydroxytryptamine (serotonin) receptor 2A
SynonymsHtr2, 5-HT2A receptor, Htr-2
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0117 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location74640840-74709494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74645093 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 173 (R173H)
Ref Sequence ENSEMBL: ENSMUSP00000047774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036653]
Predicted Effect probably damaging
Transcript: ENSMUST00000036653
AA Change: R173H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047774
Gene: ENSMUSG00000034997
AA Change: R173H

DomainStartEndE-ValueType
Pfam:7tm_4 81 264 1.2e-9 PFAM
Pfam:7TM_GPCR_Srx 82 289 1e-6 PFAM
Pfam:7TM_GPCR_Srsx 85 395 1.1e-16 PFAM
Pfam:7tm_1 91 380 5.9e-70 PFAM
Meta Mutation Damage Score 0.9627 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show altered anxiety-related responses and increased vertical activity. Mice homozygous for a different knock-out allele exhibit abnormal enterocyte, Paneth cell and smooth muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Htr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Htr2a APN 14 74706205 missense possibly damaging 0.93
IGL00946:Htr2a APN 14 74706142 nonsense probably null
IGL01660:Htr2a APN 14 74705754 missense probably damaging 1.00
IGL02200:Htr2a APN 14 74706165 missense probably damaging 1.00
IGL02369:Htr2a APN 14 74706282 missense probably benign 0.17
IGL02724:Htr2a APN 14 74645062 missense probably damaging 1.00
IGL02887:Htr2a APN 14 74645143 missense probably benign 0.05
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0367:Htr2a UTSW 14 74642209 missense probably damaging 1.00
R0513:Htr2a UTSW 14 74706324 missense probably benign 0.00
R0729:Htr2a UTSW 14 74642147 missense probably benign
R1507:Htr2a UTSW 14 74705979 missense probably damaging 1.00
R1522:Htr2a UTSW 14 74705853 nonsense probably null
R1539:Htr2a UTSW 14 74645168 missense possibly damaging 0.66
R1735:Htr2a UTSW 14 74706128 missense probably damaging 1.00
R1747:Htr2a UTSW 14 74706153 missense probably damaging 1.00
R1854:Htr2a UTSW 14 74705753 missense probably damaging 1.00
R2232:Htr2a UTSW 14 74645029 missense probably damaging 1.00
R2348:Htr2a UTSW 14 74645110 missense probably damaging 1.00
R3154:Htr2a UTSW 14 74705822 missense probably benign 0.00
R3401:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4006:Htr2a UTSW 14 74642141 missense probably benign
R4007:Htr2a UTSW 14 74642141 missense probably benign
R4093:Htr2a UTSW 14 74706349 missense probably benign
R4094:Htr2a UTSW 14 74706349 missense probably benign
R4095:Htr2a UTSW 14 74706349 missense probably benign
R4502:Htr2a UTSW 14 74641988 missense probably benign 0.02
R4720:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4932:Htr2a UTSW 14 74642022 missense probably benign
R5651:Htr2a UTSW 14 74705703 missense probably damaging 0.98
R5935:Htr2a UTSW 14 74645090 missense probably damaging 1.00
R6175:Htr2a UTSW 14 74645034 nonsense probably null
R6937:Htr2a UTSW 14 74645164 missense probably damaging 0.98
R7138:Htr2a UTSW 14 74705742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTCCCCAAGTTGTAAGTCCTG -3'
(R):5'- GGGTCAAGTGCCCATATTCCTTAGC -3'

Sequencing Primer
(F):5'- CCTGGGGTATAGATTACACGC -3'
(R):5'- CAGTCCAGTAACGATAGGTTTCG -3'
Posted On2013-04-11