Mutagenetix > Incidental Mutations

Incidental Mutation 'R0117:Sntb1'

20894

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

038403-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R0117 (G1)

Quality Score

191

Status

Validated (trace)

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55906353 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 80 (V80A)

Ref Sequence

ENSEMBL: ENSMUSP00000105829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769] [ENSMUST00000110200]

Predicted Effect

probably benign
Transcript: ENSMUST00000039769
AA Change: V80A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: V80A

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110200
AA Change: V80A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105829
Gene: ENSMUSG00000060429
AA Change: V80A

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
PDZ	120	194	4.5e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140574

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.2%
20x: 88.1%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Angptl4	A	T	17: 33,780,802	I141K	probably damaging	Het
Bbs10	T	A	10: 111,299,333	D102E	possibly damaging	Het
Btaf1	A	G	19: 36,969,968	T486A	probably benign	Het
Casp8ap2	A	G	4: 32,640,817	T624A	probably benign	Het
Cep192	T	C	18: 67,850,737		probably null	Het
Cep76	T	C	18: 67,626,674	Y323C	possibly damaging	Het
CK137956	T	A	4: 127,946,792	T374S	possibly damaging	Het
Cyp2b23	A	T	7: 26,673,114	F359I	probably benign	Het
Cyp4f13	G	T	17: 32,930,606	H194Q	probably damaging	Het
Dach1	C	T	14: 98,168,748	G188R	probably damaging	Het
Def8	G	A	8: 123,456,495	A278T	probably damaging	Het
Dscam	T	C	16: 96,673,678	H1228R	probably benign	Het
Eps15	T	A	4: 109,382,819	D667E	probably damaging	Het
Fig4	G	A	10: 41,230,041	R716*	probably null	Het
Fmnl3	G	C	15: 99,322,738		probably benign	Het
Gm10639	C	T	9: 78,304,418	T154I	probably damaging	Het
Gmpr	T	A	13: 45,517,084		probably null	Het
Helz2	C	A	2: 181,232,759	G1981C	probably damaging	Het
Herc2	C	A	7: 56,213,611		probably benign	Het
Htr2a	G	A	14: 74,645,093	R173H	probably damaging	Het
Impg2	A	G	16: 56,261,642	N979S	probably damaging	Het
Kcna2	A	G	3: 107,105,354	Y417C	probably damaging	Het
Lmf1	G	T	17: 25,655,991		probably benign	Het
Lmntd2	G	A	7: 141,210,123	R659C	possibly damaging	Het
Mcm9	A	G	10: 53,537,736	V416A	possibly damaging	Het
Mgarp	G	T	3: 51,396,712		probably benign	Het
Mpp3	G	A	11: 102,000,573	P580S	probably damaging	Het
Nfat5	C	T	8: 107,339,075	R156W	probably damaging	Het
Ninl	G	A	2: 150,937,673	R269W	probably damaging	Het
Olfr1098	T	A	2: 86,922,870	I221F	probably damaging	Het
Olfr27	T	A	9: 39,144,850	I250N	probably damaging	Het
Olfr862	T	C	9: 19,884,299	E2G	probably damaging	Het
Pcnt	A	T	10: 76,408,727	L1173*	probably null	Het
Pde6c	A	G	19: 38,151,531	E314G	probably damaging	Het
Phldb1	T	C	9: 44,711,706	M1V	probably null	Het
Pkdrej	T	A	15: 85,816,099		probably null	Het
Plch2	T	A	4: 154,985,358		probably benign	Het
Pld2	G	A	11: 70,557,388	R887Q	probably benign	Het
Plxnb1	A	G	9: 109,105,218	D838G	possibly damaging	Het
Postn	C	T	3: 54,383,481		probably benign	Het
Prl8a8	T	A	13: 27,508,490	I172F	probably damaging	Het
Psmc4	A	T	7: 28,042,740		probably benign	Het
Rabgap1	T	A	2: 37,561,885		probably null	Het
Rapgef2	A	G	3: 79,079,177	S1017P	probably benign	Het
Rbak	G	T	5: 143,173,632	Y555*	probably null	Het
Serpina1c	T	G	12: 103,895,012	*414C	probably null	Het
Sorl1	A	G	9: 42,033,577	V884A	probably benign	Het
Stmnd1	C	A	13: 46,285,486	Q65K	possibly damaging	Het
Tgm5	C	T	2: 121,075,102		probably null	Het
Tmem189	A	G	2: 167,644,758		probably benign	Het
Tubb1	T	C	2: 174,457,784	S420P	probably benign	Het
Tvp23b	T	C	11: 62,879,604		probably benign	Het
Xirp2	C	T	2: 67,517,120	A3235V	possibly damaging	Het
Zc3h15	T	C	2: 83,658,083	S122P	possibly damaging	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8242:Sntb1	UTSW	15	55792233	missense	possibly damaging	0.95
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TGCAAAACACAGGCACTGTGGG -3'
(R):5'- TGCGGGATCGCTGGCATAAAGTTC -3'

Sequencing Primer
(F):5'- TGCTCCGTTCACCGACAG -3'
(R):5'- CATAAAGTTCTGGTGAACTTGAGCG -3'

Posted On

2013-04-11