Mutagenetix > Incidental Mutations

Incidental Mutation 'R1868:Sptbn1'

208972

Institutional Source

Beutler Lab

Gene Symbol

Sptbn1

Ensembl Gene

ENSMUSG00000020315

Gene Name

spectrin beta, non-erythrocytic 1

Synonyms

non-erythrocytic, Spnb-2, elf3, 9930031C03Rik, elf1, beta fodrin, brain spectrin, spectrin G, Spnb2

MMRRC Submission

039890-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1868 (G1)

Quality Score

198

Status

Validated

Chromosome

Chromosomal Location

30099395-30268175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 30114781 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1906 (R1906L)

Ref Sequence

ENSEMBL: ENSMUSP00000011877 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006629
AA Change: R1906L

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: R1906L

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000011877
AA Change: R1906L

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: R1906L

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102838
AA Change: R1893L

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: R1893L

Domain	Start	End	E-Value	Type
CH	43	143	3.02e-28	SMART
CH	162	260	8.73e-25	SMART
SPEC	292	398	2.03e0	SMART
SPEC	412	512	6.42e-26	SMART
SPEC	518	622	4.61e-27	SMART
SPEC	628	728	2.36e-33	SMART
SPEC	734	833	1.2e-25	SMART
SPEC	839	939	7.16e-24	SMART
SPEC	945	1046	6.58e-23	SMART
SPEC	1052	1153	1.79e-24	SMART
SPEC	1159	1259	2.2e-24	SMART
SPEC	1265	1364	5.18e-21	SMART
SPEC	1370	1469	1.02e-19	SMART
SPEC	1475	1576	7.2e-29	SMART
SPEC	1582	1682	8.03e-27	SMART
SPEC	1688	1789	9.73e-26	SMART
SPEC	1795	1895	9.82e-22	SMART
SPEC	1901	2001	8.68e-23	SMART
SPEC	2007	2114	2.66e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124231
AA Change: R1906L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: R1906L

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2092	6.42e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127209

Meta Mutation Damage Score

0.1009

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

97% (115/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	T	5: 66,000,217	M1K	probably null	Het
9330182L06Rik	T	A	5: 9,479,251	I1028K	probably damaging	Het
9930021J03Rik	A	T	19: 29,743,598	S743T	probably damaging	Het
A630073D07Rik	C	T	6: 132,626,494	E100K	unknown	Het
Abcc3	T	G	11: 94,364,063	D638A	probably benign	Het
Acadm	T	C	3: 153,930,252	I272V	probably benign	Het
Adam2	G	A	14: 66,077,658	T22I	probably damaging	Het
Aldh3b1	G	A	19: 3,921,271		probably benign	Het
Arfgef3	A	T	10: 18,661,387	I182K	probably benign	Het
Arhgef17	A	G	7: 100,878,977	S677P	probably benign	Het
Atp2b1	T	C	10: 98,996,888	V417A	probably damaging	Het
Brca1	T	A	11: 101,498,013	H1675L	probably benign	Het
Btd	G	T	14: 31,667,309	G329V	probably benign	Het
Capsl	T	A	15: 9,461,830	L104*	probably null	Het
Cbx1	T	C	11: 96,802,728	S107P	probably benign	Het
Cd207	G	T	6: 83,671,701	Y326*	probably null	Het
Cenpp	T	C	13: 49,641,283	D136G	probably damaging	Het
Chsy3	A	G	18: 59,176,488		probably null	Het
Cntrl	T	A	2: 35,129,815	H551Q	probably benign	Het
Col14a1	T	A	15: 55,447,462		probably benign	Het
Cybrd1	T	A	2: 71,137,634	F183Y	possibly damaging	Het
D5Ertd577e	T	A	5: 95,482,899	Y212N	probably benign	Het
D5Ertd579e	G	A	5: 36,616,427	S208L	probably damaging	Het
Dlg2	A	T	7: 92,386,952	K719*	probably null	Het
Dppa1	A	T	11: 46,625,566		probably null	Het
Dse	A	G	10: 34,153,288	V602A	possibly damaging	Het
Elmo1	C	T	13: 20,589,653	A611V	possibly damaging	Het
Ets2	T	C	16: 95,715,074	S233P	probably benign	Het
Fam129a	A	G	1: 151,641,551	S104G	possibly damaging	Het
Fam160b1	T	C	19: 57,386,305	I704T	possibly damaging	Het
Fam198a	A	G	9: 121,965,427	T216A	possibly damaging	Het
Fchsd2	G	A	7: 101,250,438		probably benign	Het
Fkbp4	T	C	6: 128,432,490	R402G	probably benign	Het
G2e3	T	A	12: 51,353,629	D21E	probably benign	Het
Gck	A	T	11: 5,902,165	N391K	probably damaging	Het
Gm11077	T	A	6: 140,729,291	I3N	unknown	Het
Gm13762	T	C	2: 88,973,784	T36A	possibly damaging	Het
Gm6793	T	C	8: 112,014,456	M185V	probably benign	Het
Gucy2d	T	A	7: 98,454,061	L504H	probably damaging	Het
Hat1	T	A	2: 71,421,283	Y225*	probably null	Het
Iars2	A	T	1: 185,318,568	D441E	probably benign	Het
Ido2	C	A	8: 24,553,760	M92I	possibly damaging	Het
Ifne	T	C	4: 88,879,671	E170G	probably damaging	Het
Ints8	C	A	4: 11,241,684	C253F	probably damaging	Het
Intu	G	T	3: 40,664,335	G257V	probably damaging	Het
Jakmip3	A	G	7: 139,007,587	K140R	probably benign	Het
Kcnip3	T	C	2: 127,459,343	E237G	probably damaging	Het
Ksr2	A	C	5: 117,505,529	E121A	probably benign	Het
Lars	T	A	18: 42,214,837	I974F	probably benign	Het
Lce1b	A	G	3: 92,656,011	S72P	unknown	Het
Lhfpl4	T	A	6: 113,176,433	D125V	probably benign	Het
Luc7l	G	A	17: 26,280,056		probably benign	Het
Mei1	T	C	15: 82,124,953	L833P	probably damaging	Het
Mier2	A	G	10: 79,548,830	V150A	probably damaging	Het
Muc4	C	T	16: 32,756,341	R2072C	unknown	Het
Myh3	A	G	11: 67,085,026	K295E	probably benign	Het
Ndufaf5	A	G	2: 140,181,589	I115V	probably benign	Het
Neb	T	C	2: 52,326,744	K140E	probably damaging	Het
Npas2	A	G	1: 39,300,678	D103G	probably benign	Het
Ntrk3	A	T	7: 78,192,604	H825Q	possibly damaging	Het
Nup62	T	A	7: 44,829,048	S162R	possibly damaging	Het
Olfr1000	T	A	2: 85,608,065	I282F	probably damaging	Het
Olfr1086	G	A	2: 86,677,285	T16I	possibly damaging	Het
Olfr143	A	G	9: 38,253,690	E91G	probably damaging	Het
Orc4	A	G	2: 48,910,293	M281T	probably benign	Het
Osbpl5	C	A	7: 143,715,773	R22L	probably damaging	Het
Otos	A	G	1: 92,644,463	F47S	probably damaging	Het
Parp11	A	G	6: 127,470,777	T25A	probably damaging	Het
Pcdhb9	A	C	18: 37,402,084	D377A	probably damaging	Het
Pdgfra	C	T	5: 75,170,873	S348L	probably benign	Het
Pdlim5	C	A	3: 142,306,299		probably null	Het
Peg12	T	C	7: 62,463,668	H227R	probably benign	Het
Piezo2	T	C	18: 63,019,344	E2559G	probably damaging	Het
Pnisr	C	T	4: 21,874,086		probably benign	Het
Ppa2	A	T	3: 133,348,097	I183F	probably damaging	Het
Prl2a1	T	C	13: 27,804,940	L16P	probably damaging	Het
Rai14	C	A	15: 10,633,228	Q25H	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rbm34	C	A	8: 126,970,881	A27S	probably benign	Het
Rchy1	T	C	5: 91,951,903	D192G	probably damaging	Het
Rexo1	T	C	10: 80,542,920	D1094G	probably damaging	Het
Rtl1	T	A	12: 109,590,536	D1623V	probably damaging	Het
Ryr2	C	T	13: 11,731,700	E1989K	probably benign	Het
Sema6c	A	G	3: 95,170,813	E500G	probably damaging	Het
Slc13a1	T	A	6: 24,118,000	Y246F	probably damaging	Het
Slc39a9	C	T	12: 80,679,523	L249F	probably damaging	Het
Slc6a21	C	T	7: 45,287,828	P261S	probably benign	Het
Slco2b1	C	T	7: 99,686,036	C179Y	probably damaging	Het
Sox6	T	C	7: 115,659,538	N252S	possibly damaging	Het
Spr-ps1	C	T	6: 85,155,903		noncoding transcript	Het
Stac2	T	C	11: 98,052,945	D13G	probably benign	Het
Stat5a	G	T	11: 100,874,129	R226L	probably damaging	Het
Suz12	A	G	11: 80,013,599		probably null	Het
Tas2r144	C	A	6: 42,216,002	H225Q	probably benign	Het
Tdo2	T	A	3: 81,960,546	M331L	probably benign	Het
Tesk1	T	C	4: 43,447,201	W530R	probably damaging	Het
Tlr6	T	C	5: 64,954,829	N245S	probably benign	Het
Tnfrsf11a	G	T	1: 105,844,705	A573S	probably damaging	Het
Tpbpb	A	T	13: 60,902,530		probably benign	Het
Trim24	T	A	6: 37,951,512	S590T	probably damaging	Het
Ttll3	G	T	6: 113,392,764	A90S	possibly damaging	Het
Ubr5	A	T	15: 38,041,846	S169T	probably benign	Het
Usp28	T	C	9: 49,016,707	V363A	probably damaging	Het
Vcan	A	G	13: 89,690,871	S2185P	probably benign	Het
Vmn1r211	T	C	13: 22,851,609	H296R	probably benign	Het
Vmn2r3	G	A	3: 64,259,116	P865S	probably damaging	Het
Wapl	A	G	14: 34,692,458	T426A	probably benign	Het
Wdr37	G	T	13: 8,836,851	T300K	probably damaging	Het
Wrap53	A	T	11: 69,562,164	V439E	probably null	Het
Wrn	A	G	8: 33,257,221	S868P	probably benign	Het
Zfhx4	A	G	3: 5,412,714	E3463G	probably damaging	Het
Zfp189	T	A	4: 49,529,283	C129S	possibly damaging	Het
Zfp442	T	C	2: 150,408,180	K544E	probably damaging	Het
Zfp939	T	A	7: 39,473,304		noncoding transcript	Het
Zfyve26	T	C	12: 79,261,799	H228R	possibly damaging	Het

Other mutations in Sptbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sptbn1	APN	11	30110818	nonsense	probably null
IGL01098:Sptbn1	APN	11	30159385	missense	probably damaging	1.00
IGL01843:Sptbn1	APN	11	30104623	missense	probably benign	0.02
IGL02070:Sptbn1	APN	11	30145979	missense	probably damaging	0.99
IGL02075:Sptbn1	APN	11	30138496	missense	probably damaging	1.00
IGL02094:Sptbn1	APN	11	30100659	missense	probably benign	0.01
IGL02102:Sptbn1	APN	11	30137427	missense	probably damaging	1.00
IGL02189:Sptbn1	APN	11	30117871	missense	probably damaging	1.00
IGL02256:Sptbn1	APN	11	30120990	missense	probably benign	0.24
IGL02301:Sptbn1	APN	11	30142129	missense	probably damaging	1.00
IGL02354:Sptbn1	APN	11	30110783	missense	probably damaging	1.00
IGL02361:Sptbn1	APN	11	30110783	missense	probably damaging	1.00
IGL02377:Sptbn1	APN	11	30119491	missense	possibly damaging	0.92
IGL02504:Sptbn1	APN	11	30142293	missense	probably damaging	1.00
IGL02672:Sptbn1	APN	11	30137239	missense	probably damaging	1.00
IGL02733:Sptbn1	APN	11	30197747	missense	probably benign	0.12
IGL02755:Sptbn1	APN	11	30142247	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30123855	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30123855	missense	probably damaging	1.00
R0096:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0139:Sptbn1	UTSW	11	30142289	missense	probably benign	0.00
R0370:Sptbn1	UTSW	11	30121545	missense	probably benign
R0389:Sptbn1	UTSW	11	30139250	missense	possibly damaging	0.95
R0415:Sptbn1	UTSW	11	30149576	missense	probably damaging	1.00
R0552:Sptbn1	UTSW	11	30145985	missense	possibly damaging	0.92
R0601:Sptbn1	UTSW	11	30150008	missense	probably damaging	1.00
R0609:Sptbn1	UTSW	11	30138979	missense	probably damaging	1.00
R0675:Sptbn1	UTSW	11	30117903	missense	probably damaging	1.00
R0708:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0711:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0729:Sptbn1	UTSW	11	30110902	missense	probably damaging	0.96
R0755:Sptbn1	UTSW	11	30139016	missense	probably damaging	1.00
R0892:Sptbn1	UTSW	11	30142201	missense	probably damaging	1.00
R0927:Sptbn1	UTSW	11	30121591	missense	probably damaging	1.00
R1102:Sptbn1	UTSW	11	30120785	missense	possibly damaging	0.93
R1460:Sptbn1	UTSW	11	30138637	missense	possibly damaging	0.50
R1479:Sptbn1	UTSW	11	30113909	missense	probably damaging	1.00
R1496:Sptbn1	UTSW	11	30121498	missense	probably damaging	1.00
R1649:Sptbn1	UTSW	11	30137301	missense	probably damaging	0.97
R1663:Sptbn1	UTSW	11	30120783	missense	possibly damaging	0.53
R1671:Sptbn1	UTSW	11	30142245	missense	possibly damaging	0.57
R1680:Sptbn1	UTSW	11	30159371	missense	possibly damaging	0.92
R1695:Sptbn1	UTSW	11	30136124	missense	probably benign	0.13
R1918:Sptbn1	UTSW	11	30142414	missense	probably damaging	1.00
R1921:Sptbn1	UTSW	11	30104469	missense	probably damaging	0.98
R2026:Sptbn1	UTSW	11	30104559	missense	probably benign	0.02
R2038:Sptbn1	UTSW	11	30159293	critical splice donor site	probably null
R2047:Sptbn1	UTSW	11	30138360	splice site	probably benign
R2312:Sptbn1	UTSW	11	30154249	missense	probably damaging	1.00
R3430:Sptbn1	UTSW	11	30219686	missense	possibly damaging	0.67
R3624:Sptbn1	UTSW	11	30140593	missense	probably damaging	1.00
R3723:Sptbn1	UTSW	11	30137335	missense	possibly damaging	0.59
R3862:Sptbn1	UTSW	11	30142329	missense	possibly damaging	0.63
R4446:Sptbn1	UTSW	11	30139114	missense	possibly damaging	0.70
R4582:Sptbn1	UTSW	11	30219597	missense	probably damaging	1.00
R4705:Sptbn1	UTSW	11	30100660	missense	probably benign
R4707:Sptbn1	UTSW	11	30137197	missense	possibly damaging	0.61
R4718:Sptbn1	UTSW	11	30154297	missense	probably damaging	1.00
R4789:Sptbn1	UTSW	11	30117759	missense	probably benign
R4824:Sptbn1	UTSW	11	30118295	missense	possibly damaging	0.72
R4855:Sptbn1	UTSW	11	30142353	missense	probably damaging	1.00
R5009:Sptbn1	UTSW	11	30124016	missense	probably benign	0.05
R5071:Sptbn1	UTSW	11	30113854	critical splice donor site	probably null
R5153:Sptbn1	UTSW	11	30121510	missense	possibly damaging	0.82
R5334:Sptbn1	UTSW	11	30137364	missense	possibly damaging	0.92
R5462:Sptbn1	UTSW	11	30100520	missense	possibly damaging	0.94
R5523:Sptbn1	UTSW	11	30137560	missense	probably damaging	1.00
R5707:Sptbn1	UTSW	11	30143174	missense	possibly damaging	0.65
R5724:Sptbn1	UTSW	11	30144113	missense	possibly damaging	0.91
R5738:Sptbn1	UTSW	11	30145941	missense	probably damaging	1.00
R5864:Sptbn1	UTSW	11	30145925	missense	probably damaging	1.00
R5895:Sptbn1	UTSW	11	30123978	missense	probably damaging	0.99
R5932:Sptbn1	UTSW	11	30136136	missense	probably damaging	1.00
R5966:Sptbn1	UTSW	11	30124873	missense	probably damaging	1.00
R5984:Sptbn1	UTSW	11	30118464	missense	probably damaging	1.00
R6155:Sptbn1	UTSW	11	30137403	missense	probably damaging	0.99
R6163:Sptbn1	UTSW	11	30159443	nonsense	probably null
R6226:Sptbn1	UTSW	11	30136054	missense	probably damaging	1.00
R6271:Sptbn1	UTSW	11	30100660	missense	probably benign	0.00
R6443:Sptbn1	UTSW	11	30139429	missense	possibly damaging	0.56
R6591:Sptbn1	UTSW	11	30113984	missense	probably damaging	0.99
R6616:Sptbn1	UTSW	11	30124030	missense	probably benign	0.08
R6691:Sptbn1	UTSW	11	30113984	missense	probably damaging	0.99
R6751:Sptbn1	UTSW	11	30117859	missense	probably damaging	1.00
R6823:Sptbn1	UTSW	11	30114787	missense	probably damaging	1.00
R6863:Sptbn1	UTSW	11	30146777	missense	possibly damaging	0.94
R6885:Sptbn1	UTSW	11	30138634	missense	probably benign	0.26
R6892:Sptbn1	UTSW	11	30142187	missense	probably benign	0.27
R6998:Sptbn1	UTSW	11	30100633	missense	probably damaging	0.97
R7043:Sptbn1	UTSW	11	30103323	missense	probably benign	0.02
R7092:Sptbn1	UTSW	11	30137119	missense	possibly damaging	0.75
R7272:Sptbn1	UTSW	11	30114859	missense	possibly damaging	0.93
R7301:Sptbn1	UTSW	11	30117798	nonsense	probably null
R7379:Sptbn1	UTSW	11	30139292	missense	possibly damaging	0.72
R7774:Sptbn1	UTSW	11	30142142	missense	probably damaging	0.99
R7813:Sptbn1	UTSW	11	30138455	missense	probably damaging	1.00
R7837:Sptbn1	UTSW	11	30138832	missense	probably damaging	1.00
R7843:Sptbn1	UTSW	11	30154320	missense	probably damaging	1.00
R7846:Sptbn1	UTSW	11	30142153	missense	probably damaging	0.98
R7877:Sptbn1	UTSW	11	30129601	missense	possibly damaging	0.94
R7902:Sptbn1	UTSW	11	30136048	missense	probably damaging	1.00
R7920:Sptbn1	UTSW	11	30138832	missense	probably damaging	1.00
R7926:Sptbn1	UTSW	11	30154320	missense	probably damaging	1.00
R7929:Sptbn1	UTSW	11	30142153	missense	probably damaging	0.98
R7960:Sptbn1	UTSW	11	30129601	missense	possibly damaging	0.94
R7985:Sptbn1	UTSW	11	30136048	missense	probably damaging	1.00
R8060:Sptbn1	UTSW	11	30101616	missense	probably damaging	0.99
Z1176:Sptbn1	UTSW	11	30137439	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30197787	missense	probably benign	0.13
Z1177:Sptbn1	UTSW	11	30114734	missense	probably damaging	1.00
Z1177:Sptbn1	UTSW	11	30120659	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- GAAATGAGCACCACCATGGC -3'
(R):5'- ACAGTAGTGAAACCTGGCTTTTC -3'

Sequencing Primer
(F):5'- TCTTTCCATGGCAGCGG -3'
(R):5'- AGTGAAACCTGGCTTTTCTCCCC -3'

Posted On

2014-06-30