Incidental Mutation 'R1868:Rapgef6'
ID208974
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 039890-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1868 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to TGG at 54546397 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108895] [ENSMUST00000207429]
Predicted Effect probably null
Transcript: ENSMUST00000101206
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102743
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108895
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155132
Predicted Effect probably null
Transcript: ENSMUST00000207429
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (115/118)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
9330182L06Rik T A 5: 9,479,251 I1028K probably damaging Het
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
A630073D07Rik C T 6: 132,626,494 E100K unknown Het
Abcc3 T G 11: 94,364,063 D638A probably benign Het
Acadm T C 3: 153,930,252 I272V probably benign Het
Adam2 G A 14: 66,077,658 T22I probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Arfgef3 A T 10: 18,661,387 I182K probably benign Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Brca1 T A 11: 101,498,013 H1675L probably benign Het
Btd G T 14: 31,667,309 G329V probably benign Het
Capsl T A 15: 9,461,830 L104* probably null Het
Cbx1 T C 11: 96,802,728 S107P probably benign Het
Cd207 G T 6: 83,671,701 Y326* probably null Het
Cenpp T C 13: 49,641,283 D136G probably damaging Het
Chsy3 A G 18: 59,176,488 probably null Het
Cntrl T A 2: 35,129,815 H551Q probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Cybrd1 T A 2: 71,137,634 F183Y possibly damaging Het
D5Ertd577e T A 5: 95,482,899 Y212N probably benign Het
D5Ertd579e G A 5: 36,616,427 S208L probably damaging Het
Dlg2 A T 7: 92,386,952 K719* probably null Het
Dppa1 A T 11: 46,625,566 probably null Het
Dse A G 10: 34,153,288 V602A possibly damaging Het
Elmo1 C T 13: 20,589,653 A611V possibly damaging Het
Ets2 T C 16: 95,715,074 S233P probably benign Het
Fam129a A G 1: 151,641,551 S104G possibly damaging Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam198a A G 9: 121,965,427 T216A possibly damaging Het
Fchsd2 G A 7: 101,250,438 probably benign Het
Fkbp4 T C 6: 128,432,490 R402G probably benign Het
G2e3 T A 12: 51,353,629 D21E probably benign Het
Gck A T 11: 5,902,165 N391K probably damaging Het
Gm11077 T A 6: 140,729,291 I3N unknown Het
Gm13762 T C 2: 88,973,784 T36A possibly damaging Het
Gm6793 T C 8: 112,014,456 M185V probably benign Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Hat1 T A 2: 71,421,283 Y225* probably null Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Ido2 C A 8: 24,553,760 M92I possibly damaging Het
Ifne T C 4: 88,879,671 E170G probably damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Jakmip3 A G 7: 139,007,587 K140R probably benign Het
Kcnip3 T C 2: 127,459,343 E237G probably damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lars T A 18: 42,214,837 I974F probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lhfpl4 T A 6: 113,176,433 D125V probably benign Het
Luc7l G A 17: 26,280,056 probably benign Het
Mei1 T C 15: 82,124,953 L833P probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Muc4 C T 16: 32,756,341 R2072C unknown Het
Myh3 A G 11: 67,085,026 K295E probably benign Het
Ndufaf5 A G 2: 140,181,589 I115V probably benign Het
Neb T C 2: 52,326,744 K140E probably damaging Het
Npas2 A G 1: 39,300,678 D103G probably benign Het
Ntrk3 A T 7: 78,192,604 H825Q possibly damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1000 T A 2: 85,608,065 I282F probably damaging Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr143 A G 9: 38,253,690 E91G probably damaging Het
Orc4 A G 2: 48,910,293 M281T probably benign Het
Osbpl5 C A 7: 143,715,773 R22L probably damaging Het
Otos A G 1: 92,644,463 F47S probably damaging Het
Parp11 A G 6: 127,470,777 T25A probably damaging Het
Pcdhb9 A C 18: 37,402,084 D377A probably damaging Het
Pdgfra C T 5: 75,170,873 S348L probably benign Het
Pdlim5 C A 3: 142,306,299 probably null Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Piezo2 T C 18: 63,019,344 E2559G probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppa2 A T 3: 133,348,097 I183F probably damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rexo1 T C 10: 80,542,920 D1094G probably damaging Het
Rtl1 T A 12: 109,590,536 D1623V probably damaging Het
Ryr2 C T 13: 11,731,700 E1989K probably benign Het
Sema6c A G 3: 95,170,813 E500G probably damaging Het
Slc13a1 T A 6: 24,118,000 Y246F probably damaging Het
Slc39a9 C T 12: 80,679,523 L249F probably damaging Het
Slc6a21 C T 7: 45,287,828 P261S probably benign Het
Slco2b1 C T 7: 99,686,036 C179Y probably damaging Het
Sox6 T C 7: 115,659,538 N252S possibly damaging Het
Spr-ps1 C T 6: 85,155,903 noncoding transcript Het
Sptbn1 C A 11: 30,114,781 R1906L possibly damaging Het
Stac2 T C 11: 98,052,945 D13G probably benign Het
Stat5a G T 11: 100,874,129 R226L probably damaging Het
Suz12 A G 11: 80,013,599 probably null Het
Tas2r144 C A 6: 42,216,002 H225Q probably benign Het
Tdo2 T A 3: 81,960,546 M331L probably benign Het
Tesk1 T C 4: 43,447,201 W530R probably damaging Het
Tlr6 T C 5: 64,954,829 N245S probably benign Het
Tnfrsf11a G T 1: 105,844,705 A573S probably damaging Het
Tpbpb A T 13: 60,902,530 probably benign Het
Trim24 T A 6: 37,951,512 S590T probably damaging Het
Ttll3 G T 6: 113,392,764 A90S possibly damaging Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp28 T C 9: 49,016,707 V363A probably damaging Het
Vcan A G 13: 89,690,871 S2185P probably benign Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r3 G A 3: 64,259,116 P865S probably damaging Het
Wapl A G 14: 34,692,458 T426A probably benign Het
Wdr37 G T 13: 8,836,851 T300K probably damaging Het
Wrap53 A T 11: 69,562,164 V439E probably null Het
Wrn A G 8: 33,257,221 S868P probably benign Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp189 T A 4: 49,529,283 C129S possibly damaging Het
Zfp442 T C 2: 150,408,180 K544E probably damaging Het
Zfp939 T A 7: 39,473,304 noncoding transcript Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 splice site probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 splice site probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54626723 missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54625958 missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54631301 nonsense probably null
R8393:Rapgef6 UTSW 11 54687661 missense probably benign
R8465:Rapgef6 UTSW 11 54691482 missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54690237 missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54568469 missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54552874 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCCACTATGACTGGTTTGC -3'
(R):5'- GCCAGTGTCTTTAGCAACAGTAG -3'

Sequencing Primer
(F):5'- GGCCACTATGACTGGTTTGCATTAC -3'
(R):5'- CTTTAGCAACAGTAGTCATAGTTGC -3'
Posted On2014-06-30