Mutagenetix > Incidental Mutations

Incidental Mutation 'R1868:Brca1'

208981

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

039890-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1868 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101498013 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1675 (H1675L)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290]

Predicted Effect

probably benign
Transcript: ENSMUST00000017290
AA Change: H1675L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: H1675L

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156843

Meta Mutation Damage Score

0.0913

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

97% (115/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	T	5: 66,000,217	M1K	probably null	Het
9330182L06Rik	T	A	5: 9,479,251	I1028K	probably damaging	Het
9930021J03Rik	A	T	19: 29,743,598	S743T	probably damaging	Het
A630073D07Rik	C	T	6: 132,626,494	E100K	unknown	Het
Abcc3	T	G	11: 94,364,063	D638A	probably benign	Het
Acadm	T	C	3: 153,930,252	I272V	probably benign	Het
Adam2	G	A	14: 66,077,658	T22I	probably damaging	Het
Aldh3b1	G	A	19: 3,921,271		probably benign	Het
Arfgef3	A	T	10: 18,661,387	I182K	probably benign	Het
Arhgef17	A	G	7: 100,878,977	S677P	probably benign	Het
Atp2b1	T	C	10: 98,996,888	V417A	probably damaging	Het
Btd	G	T	14: 31,667,309	G329V	probably benign	Het
Capsl	T	A	15: 9,461,830	L104*	probably null	Het
Cbx1	T	C	11: 96,802,728	S107P	probably benign	Het
Cd207	G	T	6: 83,671,701	Y326*	probably null	Het
Cenpp	T	C	13: 49,641,283	D136G	probably damaging	Het
Chsy3	A	G	18: 59,176,488		probably null	Het
Cntrl	T	A	2: 35,129,815	H551Q	probably benign	Het
Col14a1	T	A	15: 55,447,462		probably benign	Het
Cybrd1	T	A	2: 71,137,634	F183Y	possibly damaging	Het
D5Ertd577e	T	A	5: 95,482,899	Y212N	probably benign	Het
D5Ertd579e	G	A	5: 36,616,427	S208L	probably damaging	Het
Dlg2	A	T	7: 92,386,952	K719*	probably null	Het
Dppa1	A	T	11: 46,625,566		probably null	Het
Dse	A	G	10: 34,153,288	V602A	possibly damaging	Het
Elmo1	C	T	13: 20,589,653	A611V	possibly damaging	Het
Ets2	T	C	16: 95,715,074	S233P	probably benign	Het
Fam129a	A	G	1: 151,641,551	S104G	possibly damaging	Het
Fam160b1	T	C	19: 57,386,305	I704T	possibly damaging	Het
Fam198a	A	G	9: 121,965,427	T216A	possibly damaging	Het
Fchsd2	G	A	7: 101,250,438		probably benign	Het
Fkbp4	T	C	6: 128,432,490	R402G	probably benign	Het
G2e3	T	A	12: 51,353,629	D21E	probably benign	Het
Gck	A	T	11: 5,902,165	N391K	probably damaging	Het
Gm11077	T	A	6: 140,729,291	I3N	unknown	Het
Gm13762	T	C	2: 88,973,784	T36A	possibly damaging	Het
Gm6793	T	C	8: 112,014,456	M185V	probably benign	Het
Gucy2d	T	A	7: 98,454,061	L504H	probably damaging	Het
Hat1	T	A	2: 71,421,283	Y225*	probably null	Het
Iars2	A	T	1: 185,318,568	D441E	probably benign	Het
Ido2	C	A	8: 24,553,760	M92I	possibly damaging	Het
Ifne	T	C	4: 88,879,671	E170G	probably damaging	Het
Ints8	C	A	4: 11,241,684	C253F	probably damaging	Het
Intu	G	T	3: 40,664,335	G257V	probably damaging	Het
Jakmip3	A	G	7: 139,007,587	K140R	probably benign	Het
Kcnip3	T	C	2: 127,459,343	E237G	probably damaging	Het
Ksr2	A	C	5: 117,505,529	E121A	probably benign	Het
Lars	T	A	18: 42,214,837	I974F	probably benign	Het
Lce1b	A	G	3: 92,656,011	S72P	unknown	Het
Lhfpl4	T	A	6: 113,176,433	D125V	probably benign	Het
Luc7l	G	A	17: 26,280,056		probably benign	Het
Mei1	T	C	15: 82,124,953	L833P	probably damaging	Het
Mier2	A	G	10: 79,548,830	V150A	probably damaging	Het
Muc4	C	T	16: 32,756,341	R2072C	unknown	Het
Myh3	A	G	11: 67,085,026	K295E	probably benign	Het
Ndufaf5	A	G	2: 140,181,589	I115V	probably benign	Het
Neb	T	C	2: 52,326,744	K140E	probably damaging	Het
Npas2	A	G	1: 39,300,678	D103G	probably benign	Het
Ntrk3	A	T	7: 78,192,604	H825Q	possibly damaging	Het
Nup62	T	A	7: 44,829,048	S162R	possibly damaging	Het
Olfr1000	T	A	2: 85,608,065	I282F	probably damaging	Het
Olfr1086	G	A	2: 86,677,285	T16I	possibly damaging	Het
Olfr143	A	G	9: 38,253,690	E91G	probably damaging	Het
Orc4	A	G	2: 48,910,293	M281T	probably benign	Het
Osbpl5	C	A	7: 143,715,773	R22L	probably damaging	Het
Otos	A	G	1: 92,644,463	F47S	probably damaging	Het
Parp11	A	G	6: 127,470,777	T25A	probably damaging	Het
Pcdhb9	A	C	18: 37,402,084	D377A	probably damaging	Het
Pdgfra	C	T	5: 75,170,873	S348L	probably benign	Het
Pdlim5	C	A	3: 142,306,299		probably null	Het
Peg12	T	C	7: 62,463,668	H227R	probably benign	Het
Piezo2	T	C	18: 63,019,344	E2559G	probably damaging	Het
Pnisr	C	T	4: 21,874,086		probably benign	Het
Ppa2	A	T	3: 133,348,097	I183F	probably damaging	Het
Prl2a1	T	C	13: 27,804,940	L16P	probably damaging	Het
Rai14	C	A	15: 10,633,228	Q25H	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rbm34	C	A	8: 126,970,881	A27S	probably benign	Het
Rchy1	T	C	5: 91,951,903	D192G	probably damaging	Het
Rexo1	T	C	10: 80,542,920	D1094G	probably damaging	Het
Rtl1	T	A	12: 109,590,536	D1623V	probably damaging	Het
Ryr2	C	T	13: 11,731,700	E1989K	probably benign	Het
Sema6c	A	G	3: 95,170,813	E500G	probably damaging	Het
Slc13a1	T	A	6: 24,118,000	Y246F	probably damaging	Het
Slc39a9	C	T	12: 80,679,523	L249F	probably damaging	Het
Slc6a21	C	T	7: 45,287,828	P261S	probably benign	Het
Slco2b1	C	T	7: 99,686,036	C179Y	probably damaging	Het
Sox6	T	C	7: 115,659,538	N252S	possibly damaging	Het
Spr-ps1	C	T	6: 85,155,903		noncoding transcript	Het
Sptbn1	C	A	11: 30,114,781	R1906L	possibly damaging	Het
Stac2	T	C	11: 98,052,945	D13G	probably benign	Het
Stat5a	G	T	11: 100,874,129	R226L	probably damaging	Het
Suz12	A	G	11: 80,013,599		probably null	Het
Tas2r144	C	A	6: 42,216,002	H225Q	probably benign	Het
Tdo2	T	A	3: 81,960,546	M331L	probably benign	Het
Tesk1	T	C	4: 43,447,201	W530R	probably damaging	Het
Tlr6	T	C	5: 64,954,829	N245S	probably benign	Het
Tnfrsf11a	G	T	1: 105,844,705	A573S	probably damaging	Het
Tpbpb	A	T	13: 60,902,530		probably benign	Het
Trim24	T	A	6: 37,951,512	S590T	probably damaging	Het
Ttll3	G	T	6: 113,392,764	A90S	possibly damaging	Het
Ubr5	A	T	15: 38,041,846	S169T	probably benign	Het
Usp28	T	C	9: 49,016,707	V363A	probably damaging	Het
Vcan	A	G	13: 89,690,871	S2185P	probably benign	Het
Vmn1r211	T	C	13: 22,851,609	H296R	probably benign	Het
Vmn2r3	G	A	3: 64,259,116	P865S	probably damaging	Het
Wapl	A	G	14: 34,692,458	T426A	probably benign	Het
Wdr37	G	T	13: 8,836,851	T300K	probably damaging	Het
Wrap53	A	T	11: 69,562,164	V439E	probably null	Het
Wrn	A	G	8: 33,257,221	S868P	probably benign	Het
Zfhx4	A	G	3: 5,412,714	E3463G	probably damaging	Het
Zfp189	T	A	4: 49,529,283	C129S	possibly damaging	Het
Zfp442	T	C	2: 150,408,180	K544E	probably damaging	Het
Zfp939	T	A	7: 39,473,304		noncoding transcript	Het
Zfyve26	T	C	12: 79,261,799	H228R	possibly damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7944:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGCCAAGTGCCTACCAGGTAA -3'
(R):5'- ATGAACGTTGGCGCTCGC -3'

Sequencing Primer
(F):5'- GTGCCTACCAGGTAAAGACTAAC -3'
(R):5'- CAGTTACAAGCTGCCATGTG -3'

Posted On

2014-06-30