Incidental Mutation 'R1868:Adam2'
ID208997
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Namea disintegrin and metallopeptidase domain 2
Synonymsfertilin beta, Ftnb, Ph30-beta
MMRRC Submission 039890-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1868 (G1)
Quality Score175
Status Validated
Chromosome14
Chromosomal Location66027329-66077733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66077658 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 22 (T22I)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
Predicted Effect probably damaging
Transcript: ENSMUST00000022618
AA Change: T22I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: T22I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225667
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (115/118)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
9330182L06Rik T A 5: 9,479,251 I1028K probably damaging Het
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
A630073D07Rik C T 6: 132,626,494 E100K unknown Het
Abcc3 T G 11: 94,364,063 D638A probably benign Het
Acadm T C 3: 153,930,252 I272V probably benign Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Arfgef3 A T 10: 18,661,387 I182K probably benign Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Brca1 T A 11: 101,498,013 H1675L probably benign Het
Btd G T 14: 31,667,309 G329V probably benign Het
Capsl T A 15: 9,461,830 L104* probably null Het
Cbx1 T C 11: 96,802,728 S107P probably benign Het
Cd207 G T 6: 83,671,701 Y326* probably null Het
Cenpp T C 13: 49,641,283 D136G probably damaging Het
Chsy3 A G 18: 59,176,488 probably null Het
Cntrl T A 2: 35,129,815 H551Q probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Cybrd1 T A 2: 71,137,634 F183Y possibly damaging Het
D5Ertd577e T A 5: 95,482,899 Y212N probably benign Het
D5Ertd579e G A 5: 36,616,427 S208L probably damaging Het
Dlg2 A T 7: 92,386,952 K719* probably null Het
Dppa1 A T 11: 46,625,566 probably null Het
Dse A G 10: 34,153,288 V602A possibly damaging Het
Elmo1 C T 13: 20,589,653 A611V possibly damaging Het
Ets2 T C 16: 95,715,074 S233P probably benign Het
Fam129a A G 1: 151,641,551 S104G possibly damaging Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam198a A G 9: 121,965,427 T216A possibly damaging Het
Fchsd2 G A 7: 101,250,438 probably benign Het
Fkbp4 T C 6: 128,432,490 R402G probably benign Het
G2e3 T A 12: 51,353,629 D21E probably benign Het
Gck A T 11: 5,902,165 N391K probably damaging Het
Gm11077 T A 6: 140,729,291 I3N unknown Het
Gm13762 T C 2: 88,973,784 T36A possibly damaging Het
Gm6793 T C 8: 112,014,456 M185V probably benign Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Hat1 T A 2: 71,421,283 Y225* probably null Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Ido2 C A 8: 24,553,760 M92I possibly damaging Het
Ifne T C 4: 88,879,671 E170G probably damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Jakmip3 A G 7: 139,007,587 K140R probably benign Het
Kcnip3 T C 2: 127,459,343 E237G probably damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lars T A 18: 42,214,837 I974F probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lhfpl4 T A 6: 113,176,433 D125V probably benign Het
Luc7l G A 17: 26,280,056 probably benign Het
Mei1 T C 15: 82,124,953 L833P probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Muc4 C T 16: 32,756,341 R2072C unknown Het
Myh3 A G 11: 67,085,026 K295E probably benign Het
Ndufaf5 A G 2: 140,181,589 I115V probably benign Het
Neb T C 2: 52,326,744 K140E probably damaging Het
Npas2 A G 1: 39,300,678 D103G probably benign Het
Ntrk3 A T 7: 78,192,604 H825Q possibly damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1000 T A 2: 85,608,065 I282F probably damaging Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr143 A G 9: 38,253,690 E91G probably damaging Het
Orc4 A G 2: 48,910,293 M281T probably benign Het
Osbpl5 C A 7: 143,715,773 R22L probably damaging Het
Otos A G 1: 92,644,463 F47S probably damaging Het
Parp11 A G 6: 127,470,777 T25A probably damaging Het
Pcdhb9 A C 18: 37,402,084 D377A probably damaging Het
Pdgfra C T 5: 75,170,873 S348L probably benign Het
Pdlim5 C A 3: 142,306,299 probably null Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Piezo2 T C 18: 63,019,344 E2559G probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppa2 A T 3: 133,348,097 I183F probably damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rexo1 T C 10: 80,542,920 D1094G probably damaging Het
Rtl1 T A 12: 109,590,536 D1623V probably damaging Het
Ryr2 C T 13: 11,731,700 E1989K probably benign Het
Sema6c A G 3: 95,170,813 E500G probably damaging Het
Slc13a1 T A 6: 24,118,000 Y246F probably damaging Het
Slc39a9 C T 12: 80,679,523 L249F probably damaging Het
Slc6a21 C T 7: 45,287,828 P261S probably benign Het
Slco2b1 C T 7: 99,686,036 C179Y probably damaging Het
Sox6 T C 7: 115,659,538 N252S possibly damaging Het
Spr-ps1 C T 6: 85,155,903 noncoding transcript Het
Sptbn1 C A 11: 30,114,781 R1906L possibly damaging Het
Stac2 T C 11: 98,052,945 D13G probably benign Het
Stat5a G T 11: 100,874,129 R226L probably damaging Het
Suz12 A G 11: 80,013,599 probably null Het
Tas2r144 C A 6: 42,216,002 H225Q probably benign Het
Tdo2 T A 3: 81,960,546 M331L probably benign Het
Tesk1 T C 4: 43,447,201 W530R probably damaging Het
Tlr6 T C 5: 64,954,829 N245S probably benign Het
Tnfrsf11a G T 1: 105,844,705 A573S probably damaging Het
Tpbpb A T 13: 60,902,530 probably benign Het
Trim24 T A 6: 37,951,512 S590T probably damaging Het
Ttll3 G T 6: 113,392,764 A90S possibly damaging Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp28 T C 9: 49,016,707 V363A probably damaging Het
Vcan A G 13: 89,690,871 S2185P probably benign Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r3 G A 3: 64,259,116 P865S probably damaging Het
Wapl A G 14: 34,692,458 T426A probably benign Het
Wdr37 G T 13: 8,836,851 T300K probably damaging Het
Wrap53 A T 11: 69,562,164 V439E probably null Het
Wrn A G 8: 33,257,221 S868P probably benign Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp189 T A 4: 49,529,283 C129S possibly damaging Het
Zfp442 T C 2: 150,408,180 K544E probably damaging Het
Zfp939 T A 7: 39,473,304 noncoding transcript Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66074049 critical splice donor site probably null
IGL00980:Adam2 APN 14 66056528 nonsense probably null
IGL01404:Adam2 APN 14 66077210 critical splice donor site probably null
IGL01901:Adam2 APN 14 66035229 splice site probably benign
IGL02687:Adam2 APN 14 66069190 missense probably damaging 1.00
IGL02692:Adam2 APN 14 66074087 missense probably damaging 1.00
IGL02695:Adam2 APN 14 66050480 missense probably benign 0.01
IGL02798:Adam2 APN 14 66040275 missense probably damaging 1.00
IGL03217:Adam2 APN 14 66034813 missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66053831 missense probably benign 0.03
sacher UTSW 14 66068558 missense probably damaging 1.00
zuker UTSW 14 66059912 missense probably benign 0.14
R0092:Adam2 UTSW 14 66053887 missense probably damaging 1.00
R0281:Adam2 UTSW 14 66037606 missense probably benign 0.20
R0636:Adam2 UTSW 14 66034816 missense probably benign 0.03
R0690:Adam2 UTSW 14 66057646 missense probably damaging 1.00
R0727:Adam2 UTSW 14 66029731 missense probably damaging 1.00
R1477:Adam2 UTSW 14 66077700 missense possibly damaging 0.96
R1634:Adam2 UTSW 14 66057731 missense probably damaging 1.00
R1652:Adam2 UTSW 14 66077251 missense probably benign 0.41
R1717:Adam2 UTSW 14 66068558 missense probably damaging 1.00
R1915:Adam2 UTSW 14 66037557 missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66059912 missense probably benign 0.14
R3953:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3954:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3955:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3956:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3957:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R4091:Adam2 UTSW 14 66029723 missense probably damaging 0.97
R5673:Adam2 UTSW 14 66069232 missense probably benign 0.03
R5761:Adam2 UTSW 14 66046146 missense probably damaging 1.00
R6187:Adam2 UTSW 14 66068619 missense possibly damaging 0.89
R6499:Adam2 UTSW 14 66058790 missense probably damaging 1.00
R6730:Adam2 UTSW 14 66037576 missense possibly damaging 0.83
R6829:Adam2 UTSW 14 66027997 critical splice donor site probably null
R7023:Adam2 UTSW 14 66043056 missense probably benign 0.22
R7168:Adam2 UTSW 14 66058792 missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66053912 nonsense probably null
R7293:Adam2 UTSW 14 66035185 missense probably benign 0.29
R7604:Adam2 UTSW 14 66056541 missense probably benign 0.17
R7765:Adam2 UTSW 14 66059896 missense probably damaging 1.00
R8380:Adam2 UTSW 14 66037557 missense probably benign 0.01
R8532:Adam2 UTSW 14 66056521 missense probably damaging 1.00
R8728:Adam2 UTSW 14 66057637 missense probably damaging 1.00
R8744:Adam2 UTSW 14 66034716 critical splice donor site probably null
X0061:Adam2 UTSW 14 66053905 missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66056521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCATGCATTCGTTTTG -3'
(R):5'- GGTCTCAGATTTCAAACCCCAG -3'

Sequencing Primer
(F):5'- GCATTCGTTTTGCATTTCAGCTG -3'
(R):5'- GTTTCAAAGCTTTCACCGAGCAG -3'
Posted On2014-06-30