Mutagenetix > Incidental Mutation

Incidental Mutation 'R1868:Piezo2'

209010

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

039890-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1868 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63019344 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2559 (E2559G)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: E2559G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: E2559G

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123322

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132576

Predicted Effect

unknown
Transcript: ENSMUST00000137141
AA Change: E381G

SMART Domains

Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482
AA Change: E381G

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	235	409	4.6e-78	PFAM

Meta Mutation Damage Score

0.1813

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

97% (115/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	T	5: 66,000,217	M1K	probably null	Het
9330182L06Rik	T	A	5: 9,479,251	I1028K	probably damaging	Het
9930021J03Rik	A	T	19: 29,743,598	S743T	probably damaging	Het
A630073D07Rik	C	T	6: 132,626,494	E100K	unknown	Het
Abcc3	T	G	11: 94,364,063	D638A	probably benign	Het
Acadm	T	C	3: 153,930,252	I272V	probably benign	Het
Adam2	G	A	14: 66,077,658	T22I	probably damaging	Het
Aldh3b1	G	A	19: 3,921,271		probably benign	Het
Arfgef3	A	T	10: 18,661,387	I182K	probably benign	Het
Arhgef17	A	G	7: 100,878,977	S677P	probably benign	Het
Atp2b1	T	C	10: 98,996,888	V417A	probably damaging	Het
Brca1	T	A	11: 101,498,013	H1675L	probably benign	Het
Btd	G	T	14: 31,667,309	G329V	probably benign	Het
Capsl	T	A	15: 9,461,830	L104*	probably null	Het
Cbx1	T	C	11: 96,802,728	S107P	probably benign	Het
Cd207	G	T	6: 83,671,701	Y326*	probably null	Het
Cenpp	T	C	13: 49,641,283	D136G	probably damaging	Het
Chsy3	A	G	18: 59,176,488		probably null	Het
Cntrl	T	A	2: 35,129,815	H551Q	probably benign	Het
Col14a1	T	A	15: 55,447,462		probably benign	Het
Cybrd1	T	A	2: 71,137,634	F183Y	possibly damaging	Het
D5Ertd577e	T	A	5: 95,482,899	Y212N	probably benign	Het
D5Ertd579e	G	A	5: 36,616,427	S208L	probably damaging	Het
Dlg2	A	T	7: 92,386,952	K719*	probably null	Het
Dppa1	A	T	11: 46,625,566		probably null	Het
Dse	A	G	10: 34,153,288	V602A	possibly damaging	Het
Elmo1	C	T	13: 20,589,653	A611V	possibly damaging	Het
Ets2	T	C	16: 95,715,074	S233P	probably benign	Het
Fam129a	A	G	1: 151,641,551	S104G	possibly damaging	Het
Fam160b1	T	C	19: 57,386,305	I704T	possibly damaging	Het
Fam198a	A	G	9: 121,965,427	T216A	possibly damaging	Het
Fchsd2	G	A	7: 101,250,438		probably benign	Het
Fkbp4	T	C	6: 128,432,490	R402G	probably benign	Het
G2e3	T	A	12: 51,353,629	D21E	probably benign	Het
Gck	A	T	11: 5,902,165	N391K	probably damaging	Het
Gm11077	T	A	6: 140,729,291	I3N	unknown	Het
Gm13762	T	C	2: 88,973,784	T36A	possibly damaging	Het
Gm6793	T	C	8: 112,014,456	M185V	probably benign	Het
Gucy2d	T	A	7: 98,454,061	L504H	probably damaging	Het
Hat1	T	A	2: 71,421,283	Y225*	probably null	Het
Iars2	A	T	1: 185,318,568	D441E	probably benign	Het
Ido2	C	A	8: 24,553,760	M92I	possibly damaging	Het
Ifne	T	C	4: 88,879,671	E170G	probably damaging	Het
Ints8	C	A	4: 11,241,684	C253F	probably damaging	Het
Intu	G	T	3: 40,664,335	G257V	probably damaging	Het
Jakmip3	A	G	7: 139,007,587	K140R	probably benign	Het
Kcnip3	T	C	2: 127,459,343	E237G	probably damaging	Het
Ksr2	A	C	5: 117,505,529	E121A	probably benign	Het
Lars	T	A	18: 42,214,837	I974F	probably benign	Het
Lce1b	A	G	3: 92,656,011	S72P	unknown	Het
Lhfpl4	T	A	6: 113,176,433	D125V	probably benign	Het
Luc7l	G	A	17: 26,280,056		probably benign	Het
Mei1	T	C	15: 82,124,953	L833P	probably damaging	Het
Mier2	A	G	10: 79,548,830	V150A	probably damaging	Het
Muc4	C	T	16: 32,756,341	R2072C	unknown	Het
Myh3	A	G	11: 67,085,026	K295E	probably benign	Het
Ndufaf5	A	G	2: 140,181,589	I115V	probably benign	Het
Neb	T	C	2: 52,326,744	K140E	probably damaging	Het
Npas2	A	G	1: 39,300,678	D103G	probably benign	Het
Ntrk3	A	T	7: 78,192,604	H825Q	possibly damaging	Het
Nup62	T	A	7: 44,829,048	S162R	possibly damaging	Het
Olfr1000	T	A	2: 85,608,065	I282F	probably damaging	Het
Olfr1086	G	A	2: 86,677,285	T16I	possibly damaging	Het
Olfr143	A	G	9: 38,253,690	E91G	probably damaging	Het
Orc4	A	G	2: 48,910,293	M281T	probably benign	Het
Osbpl5	C	A	7: 143,715,773	R22L	probably damaging	Het
Otos	A	G	1: 92,644,463	F47S	probably damaging	Het
Parp11	A	G	6: 127,470,777	T25A	probably damaging	Het
Pcdhb9	A	C	18: 37,402,084	D377A	probably damaging	Het
Pdgfra	C	T	5: 75,170,873	S348L	probably benign	Het
Pdlim5	C	A	3: 142,306,299		probably null	Het
Peg12	T	C	7: 62,463,668	H227R	probably benign	Het
Pnisr	C	T	4: 21,874,086		probably benign	Het
Ppa2	A	T	3: 133,348,097	I183F	probably damaging	Het
Prl2a1	T	C	13: 27,804,940	L16P	probably damaging	Het
Rai14	C	A	15: 10,633,228	Q25H	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rbm34	C	A	8: 126,970,881	A27S	probably benign	Het
Rchy1	T	C	5: 91,951,903	D192G	probably damaging	Het
Rexo1	T	C	10: 80,542,920	D1094G	probably damaging	Het
Rtl1	T	A	12: 109,590,536	D1623V	probably damaging	Het
Ryr2	C	T	13: 11,731,700	E1989K	probably benign	Het
Sema6c	A	G	3: 95,170,813	E500G	probably damaging	Het
Slc13a1	T	A	6: 24,118,000	Y246F	probably damaging	Het
Slc39a9	C	T	12: 80,679,523	L249F	probably damaging	Het
Slc6a21	C	T	7: 45,287,828	P261S	probably benign	Het
Slco2b1	C	T	7: 99,686,036	C179Y	probably damaging	Het
Sox6	T	C	7: 115,659,538	N252S	possibly damaging	Het
Spr-ps1	C	T	6: 85,155,903		noncoding transcript	Het
Sptbn1	C	A	11: 30,114,781	R1906L	possibly damaging	Het
Stac2	T	C	11: 98,052,945	D13G	probably benign	Het
Stat5a	G	T	11: 100,874,129	R226L	probably damaging	Het
Suz12	A	G	11: 80,013,599		probably null	Het
Tas2r144	C	A	6: 42,216,002	H225Q	probably benign	Het
Tdo2	T	A	3: 81,960,546	M331L	probably benign	Het
Tesk1	T	C	4: 43,447,201	W530R	probably damaging	Het
Tlr6	T	C	5: 64,954,829	N245S	probably benign	Het
Tnfrsf11a	G	T	1: 105,844,705	A573S	probably damaging	Het
Tpbpb	A	T	13: 60,902,530		probably benign	Het
Trim24	T	A	6: 37,951,512	S590T	probably damaging	Het
Ttll3	G	T	6: 113,392,764	A90S	possibly damaging	Het
Ubr5	A	T	15: 38,041,846	S169T	probably benign	Het
Usp28	T	C	9: 49,016,707	V363A	probably damaging	Het
Vcan	A	G	13: 89,690,871	S2185P	probably benign	Het
Vmn1r211	T	C	13: 22,851,609	H296R	probably benign	Het
Vmn2r3	G	A	3: 64,259,116	P865S	probably damaging	Het
Wapl	A	G	14: 34,692,458	T426A	probably benign	Het
Wdr37	G	T	13: 8,836,851	T300K	probably damaging	Het
Wrap53	A	T	11: 69,562,164	V439E	probably null	Het
Wrn	A	G	8: 33,257,221	S868P	probably benign	Het
Zfhx4	A	G	3: 5,412,714	E3463G	probably damaging	Het
Zfp189	T	A	4: 49,529,283	C129S	possibly damaging	Het
Zfp442	T	C	2: 150,408,180	K544E	probably damaging	Het
Zfp939	T	A	7: 39,473,304		noncoding transcript	Het
Zfyve26	T	C	12: 79,261,799	H228R	possibly damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63117699	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63022460	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63070030	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63124614	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63030392	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63182833	splice site	probably benign
IGL01674:Piezo2	APN	18	63027559	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63083170	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63042788	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63092844	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63020634	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63146844	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63072862	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63032924	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63024475	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63074659	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63064785	splice site	probably benign
IGL03011:Piezo2	APN	18	63124660	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63070075	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63030272	splice site	probably null
IGL03129:Piezo2	APN	18	63114972	missense	probably benign
IGL03143:Piezo2	APN	18	63108076	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63011598	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63124606	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63053062	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63041720	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63011538	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63021308	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63027704	missense	probably damaging	1.00
Piccolo	UTSW	18	63011696	missense	probably damaging	1.00
sopranino	UTSW	18	63024466	missense	probably damaging	1.00
woodwind	UTSW	18	63124642	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63386200	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63024469	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63102084	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63024491	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63029061	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63102174	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63024451	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63027544	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63022481	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63022426	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63019258	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63041723	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63083235	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63015802	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63086753	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63021254	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63083131	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63144919	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63082915	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63117672	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63021173	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63124642	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63106284	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63032840	critical splice donor site	probably null
R1799:Piezo2	UTSW	18	63108087	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63113960	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63078840	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63078781	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63144926	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63059744	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63118935	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63081734	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63117720	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63114041	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63106274	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63022525	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63245624	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63053035	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63146843	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63024435	nonsense	probably null
R3016:Piezo2	UTSW	18	63042832	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63081793	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63050604	missense	probably benign
R4181:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63084840	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63102099	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63114063	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63072880	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63086628	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63069963	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63144954	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63078791	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63157262	missense	probably benign
R4961:Piezo2	UTSW	18	63052961	splice site	probably null
R4968:Piezo2	UTSW	18	63144971	nonsense	probably null
R4973:Piezo2	UTSW	18	63074680	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63083113	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63024536	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63074620	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63030409	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63032929	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63064731	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63084740	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63145105	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63027864	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63011721	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63145091	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117696	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117697	missense	probably benign	0.25
R5792:Piezo2	UTSW	18	63146856	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63027901	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63113934	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6073:Piezo2	UTSW	18	63012645	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63157210	nonsense	probably null
R6255:Piezo2	UTSW	18	63121270	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63117678	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63106293	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63086607	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63041663	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63106271	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63021328	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63021262	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63032889	nonsense	probably null
R6855:Piezo2	UTSW	18	63090879	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63032986	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63082961	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63145110	nonsense	probably null
R7162:Piezo2	UTSW	18	63124709	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63108030	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63017519	splice site	probably null
R7395:Piezo2	UTSW	18	63027563	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63024472	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63012723	missense	probably benign
R7517:Piezo2	UTSW	18	63082925	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63053010	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63042539	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63113876	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63082945	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63083200	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63042811	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63030466	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63075730	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63012786	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63084688	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63045540	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63146802	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63092900	nonsense	probably null
R8708:Piezo2	UTSW	18	63093015	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63109885	missense	probably benign
R8727:Piezo2	UTSW	18	63109885	missense	probably benign
R8810:Piezo2	UTSW	18	63114963	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63115025	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63092831	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63024466	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63045479	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63117744	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63157231	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63021301	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63075797	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63024566	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63029085	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63102165	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
X0017:Piezo2	UTSW	18	63027586	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63050610	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63017577	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63069994	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGCCTGAGGTAAGGTTAGG -3'
(R):5'- GATGGCTAAATACCTGTTGGGC -3'

Sequencing Primer
(F):5'- CAGCCTGAGGTAAGGTTAGGAAAAG -3'
(R):5'- CTGTTGGGCAGGCGGTG -3'

Posted On

2014-06-30