Mutagenetix > Incidental Mutations

Incidental Mutation 'R1868:Piezo2'

209010

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

039890-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1868 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63019344 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2559 (E2559G)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: E2559G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: E2559G

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123322

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132576

Predicted Effect

unknown
Transcript: ENSMUST00000137141
AA Change: E381G

SMART Domains

Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482
AA Change: E381G

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	235	409	4.6e-78	PFAM

Meta Mutation Damage Score

0.1813

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

97% (115/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	T	5: 66,000,217	M1K	probably null	Het
9330182L06Rik	T	A	5: 9,479,251	I1028K	probably damaging	Het
9930021J03Rik	A	T	19: 29,743,598	S743T	probably damaging	Het
A630073D07Rik	C	T	6: 132,626,494	E100K	unknown	Het
Abcc3	T	G	11: 94,364,063	D638A	probably benign	Het
Acadm	T	C	3: 153,930,252	I272V	probably benign	Het
Adam2	G	A	14: 66,077,658	T22I	probably damaging	Het
Aldh3b1	G	A	19: 3,921,271		probably benign	Het
Arfgef3	A	T	10: 18,661,387	I182K	probably benign	Het
Arhgef17	A	G	7: 100,878,977	S677P	probably benign	Het
Atp2b1	T	C	10: 98,996,888	V417A	probably damaging	Het
Brca1	T	A	11: 101,498,013	H1675L	probably benign	Het
Btd	G	T	14: 31,667,309	G329V	probably benign	Het
Capsl	T	A	15: 9,461,830	L104*	probably null	Het
Cbx1	T	C	11: 96,802,728	S107P	probably benign	Het
Cd207	G	T	6: 83,671,701	Y326*	probably null	Het
Cenpp	T	C	13: 49,641,283	D136G	probably damaging	Het
Chsy3	A	G	18: 59,176,488		probably null	Het
Cntrl	T	A	2: 35,129,815	H551Q	probably benign	Het
Col14a1	T	A	15: 55,447,462		probably benign	Het
Cybrd1	T	A	2: 71,137,634	F183Y	possibly damaging	Het
D5Ertd577e	T	A	5: 95,482,899	Y212N	probably benign	Het
D5Ertd579e	G	A	5: 36,616,427	S208L	probably damaging	Het
Dlg2	A	T	7: 92,386,952	K719*	probably null	Het
Dppa1	A	T	11: 46,625,566		probably null	Het
Dse	A	G	10: 34,153,288	V602A	possibly damaging	Het
Elmo1	C	T	13: 20,589,653	A611V	possibly damaging	Het
Ets2	T	C	16: 95,715,074	S233P	probably benign	Het
Fam129a	A	G	1: 151,641,551	S104G	possibly damaging	Het
Fam160b1	T	C	19: 57,386,305	I704T	possibly damaging	Het
Fam198a	A	G	9: 121,965,427	T216A	possibly damaging	Het
Fchsd2	G	A	7: 101,250,438		probably benign	Het
Fkbp4	T	C	6: 128,432,490	R402G	probably benign	Het
G2e3	T	A	12: 51,353,629	D21E	probably benign	Het
Gck	A	T	11: 5,902,165	N391K	probably damaging	Het
Gm11077	T	A	6: 140,729,291	I3N	unknown	Het
Gm13762	T	C	2: 88,973,784	T36A	possibly damaging	Het
Gm6793	T	C	8: 112,014,456	M185V	probably benign	Het
Gucy2d	T	A	7: 98,454,061	L504H	probably damaging	Het
Hat1	T	A	2: 71,421,283	Y225*	probably null	Het
Iars2	A	T	1: 185,318,568	D441E	probably benign	Het
Ido2	C	A	8: 24,553,760	M92I	possibly damaging	Het
Ifne	T	C	4: 88,879,671	E170G	probably damaging	Het
Ints8	C	A	4: 11,241,684	C253F	probably damaging	Het
Intu	G	T	3: 40,664,335	G257V	probably damaging	Het
Jakmip3	A	G	7: 139,007,587	K140R	probably benign	Het
Kcnip3	T	C	2: 127,459,343	E237G	probably damaging	Het
Ksr2	A	C	5: 117,505,529	E121A	probably benign	Het
Lars	T	A	18: 42,214,837	I974F	probably benign	Het
Lce1b	A	G	3: 92,656,011	S72P	unknown	Het
Lhfpl4	T	A	6: 113,176,433	D125V	probably benign	Het
Luc7l	G	A	17: 26,280,056		probably benign	Het
Mei1	T	C	15: 82,124,953	L833P	probably damaging	Het
Mier2	A	G	10: 79,548,830	V150A	probably damaging	Het
Muc4	C	T	16: 32,756,341	R2072C	unknown	Het
Myh3	A	G	11: 67,085,026	K295E	probably benign	Het
Ndufaf5	A	G	2: 140,181,589	I115V	probably benign	Het
Neb	T	C	2: 52,326,744	K140E	probably damaging	Het
Npas2	A	G	1: 39,300,678	D103G	probably benign	Het
Ntrk3	A	T	7: 78,192,604	H825Q	possibly damaging	Het
Nup62	T	A	7: 44,829,048	S162R	possibly damaging	Het
Olfr1000	T	A	2: 85,608,065	I282F	probably damaging	Het
Olfr1086	G	A	2: 86,677,285	T16I	possibly damaging	Het
Olfr143	A	G	9: 38,253,690	E91G	probably damaging	Het
Orc4	A	G	2: 48,910,293	M281T	probably benign	Het
Osbpl5	C	A	7: 143,715,773	R22L	probably damaging	Het
Otos	A	G	1: 92,644,463	F47S	probably damaging	Het
Parp11	A	G	6: 127,470,777	T25A	probably damaging	Het
Pcdhb9	A	C	18: 37,402,084	D377A	probably damaging	Het
Pdgfra	C	T	5: 75,170,873	S348L	probably benign	Het
Pdlim5	C	A	3: 142,306,299		probably null	Het
Peg12	T	C	7: 62,463,668	H227R	probably benign	Het
Pnisr	C	T	4: 21,874,086		probably benign	Het
Ppa2	A	T	3: 133,348,097	I183F	probably damaging	Het
Prl2a1	T	C	13: 27,804,940	L16P	probably damaging	Het
Rai14	C	A	15: 10,633,228	Q25H	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rbm34	C	A	8: 126,970,881	A27S	probably benign	Het
Rchy1	T	C	5: 91,951,903	D192G	probably damaging	Het
Rexo1	T	C	10: 80,542,920	D1094G	probably damaging	Het
Rtl1	T	A	12: 109,590,536	D1623V	probably damaging	Het
Ryr2	C	T	13: 11,731,700	E1989K	probably benign	Het
Sema6c	A	G	3: 95,170,813	E500G	probably damaging	Het
Slc13a1	T	A	6: 24,118,000	Y246F	probably damaging	Het
Slc39a9	C	T	12: 80,679,523	L249F	probably damaging	Het
Slc6a21	C	T	7: 45,287,828	P261S	probably benign	Het
Slco2b1	C	T	7: 99,686,036	C179Y	probably damaging	Het
Sox6	T	C	7: 115,659,538	N252S	possibly damaging	Het
Spr-ps1	C	T	6: 85,155,903		noncoding transcript	Het
Sptbn1	C	A	11: 30,114,781	R1906L	possibly damaging	Het
Stac2	T	C	11: 98,052,945	D13G	probably benign	Het
Stat5a	G	T	11: 100,874,129	R226L	probably damaging	Het
Suz12	A	G	11: 80,013,599		probably null	Het
Tas2r144	C	A	6: 42,216,002	H225Q	probably benign	Het
Tdo2	T	A	3: 81,960,546	M331L	probably benign	Het
Tesk1	T	C	4: 43,447,201	W530R	probably damaging	Het
Tlr6	T	C	5: 64,954,829	N245S	probably benign	Het
Tnfrsf11a	G	T	1: 105,844,705	A573S	probably damaging	Het
Tpbpb	A	T	13: 60,902,530		probably benign	Het
Trim24	T	A	6: 37,951,512	S590T	probably damaging	Het
Ttll3	G	T	6: 113,392,764	A90S	possibly damaging	Het
Ubr5	A	T	15: 38,041,846	S169T	probably benign	Het
Usp28	T	C	9: 49,016,707	V363A	probably damaging	Het
Vcan	A	G	13: 89,690,871	S2185P	probably benign	Het
Vmn1r211	T	C	13: 22,851,609	H296R	probably benign	Het
Vmn2r3	G	A	3: 64,259,116	P865S	probably damaging	Het
Wapl	A	G	14: 34,692,458	T426A	probably benign	Het
Wdr37	G	T	13: 8,836,851	T300K	probably damaging	Het
Wrap53	A	T	11: 69,562,164	V439E	probably null	Het
Wrn	A	G	8: 33,257,221	S868P	probably benign	Het
Zfhx4	A	G	3: 5,412,714	E3463G	probably damaging	Het
Zfp189	T	A	4: 49,529,283	C129S	possibly damaging	Het
Zfp442	T	C	2: 150,408,180	K544E	probably damaging	Het
Zfp939	T	A	7: 39,473,304		noncoding transcript	Het
Zfyve26	T	C	12: 79,261,799	H228R	possibly damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63117699	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63022460	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63070030	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63124614	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63030392	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63182833	splice site	probably benign
IGL01674:Piezo2	APN	18	63027559	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63083170	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63042788	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63092844	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63020634	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63146844	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63072862	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63032924	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63024475	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63074659	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63064785	splice site	probably benign
IGL03011:Piezo2	APN	18	63124660	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63070075	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63030272	splice site	probably null
IGL03129:Piezo2	APN	18	63114972	missense	probably benign
IGL03143:Piezo2	APN	18	63108076	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63011598	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63124606	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63053062	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63041720	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63011538	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63021308	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63027704	missense	probably damaging	1.00
Piccolo	UTSW	18	63011696	missense	probably damaging	1.00
P0023:Piezo2	UTSW	18	63386200	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63024469	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63102084	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63024491	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63029061	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63102174	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63024451	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63027544	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63022481	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63022426	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63019258	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63041723	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63083235	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63015802	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63086753	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63021254	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63083131	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63144919	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63082915	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63117672	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63021173	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63124642	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63106284	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63032840	critical splice donor site	probably null
R1799:Piezo2	UTSW	18	63108087	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63113960	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63078840	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63078781	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63144926	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63059744	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63118935	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63081734	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63117720	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63114041	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63106274	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63022525	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63245624	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63053035	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63146843	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63024435	nonsense	probably null
R3016:Piezo2	UTSW	18	63042832	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63081793	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63050604	missense	probably benign
R4181:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63084840	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63102099	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63114063	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63072880	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63086628	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63069963	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63144954	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63078791	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63157262	missense	probably benign
R4961:Piezo2	UTSW	18	63052961	splice site	probably null
R4968:Piezo2	UTSW	18	63144971	nonsense	probably null
R4973:Piezo2	UTSW	18	63074680	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63083113	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63024536	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63074620	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63030409	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63032929	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63064731	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63084740	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63145105	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63027864	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63011721	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63145091	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117696	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117697	missense	probably benign	0.25
R5792:Piezo2	UTSW	18	63146856	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63027901	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63113934	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6073:Piezo2	UTSW	18	63012645	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63157210	nonsense	probably null
R6255:Piezo2	UTSW	18	63121270	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63117678	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63106293	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63086607	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63041663	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63106271	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63021328	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63021262	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63032889	nonsense	probably null
R6855:Piezo2	UTSW	18	63090879	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63032986	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63082961	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63145110	nonsense	probably null
R7162:Piezo2	UTSW	18	63124709	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63108030	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63017519	splice site	probably null
R7395:Piezo2	UTSW	18	63027563	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63024472	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63012723	missense	probably benign
R7517:Piezo2	UTSW	18	63082925	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63053010	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63042539	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63113876	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63082945	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63083200	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63042811	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63030466	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63075730	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63012786	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63084688	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63045540	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63146802	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63092900	nonsense	probably null
R8708:Piezo2	UTSW	18	63093015	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63109885	missense	probably benign
R8727:Piezo2	UTSW	18	63109885	missense	probably benign
R8810:Piezo2	UTSW	18	63114963	missense	probably benign	0.41
X0017:Piezo2	UTSW	18	63027586	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63050610	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63017577	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63069994	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGCCTGAGGTAAGGTTAGG -3'
(R):5'- GATGGCTAAATACCTGTTGGGC -3'

Sequencing Primer
(F):5'- CAGCCTGAGGTAAGGTTAGGAAAAG -3'
(R):5'- CTGTTGGGCAGGCGGTG -3'

Posted On

2014-06-30