Incidental Mutation 'R1880:Kel'
ID209029
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 039901-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1880 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41687545 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 653 (L653F)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031899
AA Change: L653F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: L653F

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031900
SMART Domains Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF4717 37 107 7.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153760
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Predicted Effect probably benign
Transcript: ENSMUST00000194597
SMART Domains Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

DomainStartEndE-ValueType
Pfam:Peptidase_M13 16 68 3.6e-10 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik C A 19: 29,718,123 L1323F probably benign Het
Afdn A G 17: 13,852,353 D846G possibly damaging Het
Arhgef5 C A 6: 43,273,088 Q258K possibly damaging Het
Atp10b G T 11: 43,259,432 G1319V probably damaging Het
Axl T C 7: 25,774,548 T315A probably damaging Het
Btnl2 A G 17: 34,365,363 E420G possibly damaging Het
Capn2 A G 1: 182,489,016 W293R probably damaging Het
Cd209f A G 8: 4,105,464 probably null Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Col1a1 A G 11: 94,950,568 K1259R unknown Het
Dpysl3 A T 18: 43,329,874 probably null Het
Dus4l T C 12: 31,640,870 I261V probably benign Het
Ell3 T C 2: 121,440,311 D247G probably benign Het
Erg G A 16: 95,377,309 T246I probably benign Het
Eva1c T C 16: 90,897,415 I196T possibly damaging Het
Fbxo43 T C 15: 36,162,515 D182G probably benign Het
Frrs1 T C 3: 116,896,795 probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gata4 G T 14: 63,204,695 P20Q probably damaging Het
Gm15448 C T 7: 3,824,951 probably null Het
Gmnc T C 16: 26,965,611 D48G probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Habp2 A G 19: 56,317,828 I481V possibly damaging Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Hnrnpul1 A G 7: 25,733,098 V380A possibly damaging Het
Hspa2 G A 12: 76,405,920 D463N possibly damaging Het
Itga11 A G 9: 62,677,949 D2G probably benign Het
Lgr5 T C 10: 115,452,279 Y748C probably damaging Het
Lpxn A G 19: 12,804,088 K57E probably benign Het
Ltbp2 G T 12: 84,829,271 H501N probably benign Het
Macf1 G A 4: 123,438,591 A2419V probably damaging Het
Map3k12 A G 15: 102,502,064 probably null Het
Megf8 G A 7: 25,334,860 V668I possibly damaging Het
Mmp10 T C 9: 7,505,574 S280P probably benign Het
Neb C A 2: 52,258,731 M2601I probably damaging Het
Nsd1 T A 13: 55,213,793 N191K probably damaging Het
Olfr1137 C A 2: 87,711,295 G204C probably damaging Het
Olfr263 A T 13: 21,133,632 N286Y probably damaging Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr807 A G 10: 129,755,421 F10L probably benign Het
Patj C T 4: 98,497,240 P364S probably benign Het
Pex1 T C 5: 3,605,770 V39A probably benign Het
Pkhd1l1 A T 15: 44,525,242 I1332F probably benign Het
Polq T C 16: 37,086,592 V2026A possibly damaging Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Ppp4r4 T A 12: 103,605,035 Y678N possibly damaging Het
Rpf2 T C 10: 40,233,158 D95G possibly damaging Het
Sema3c A T 5: 17,727,466 K656* probably null Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Snap25 G A 2: 136,777,385 V153M probably damaging Het
Snrnp70 T C 7: 45,377,362 probably null Het
Tas2r144 C T 6: 42,216,070 T248I probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Usp38 T C 8: 81,001,066 E346G probably damaging Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r91 A T 7: 20,101,773 S206C probably damaging Het
Vps36 T C 8: 22,213,562 probably null Het
Wdfy3 T C 5: 101,917,435 N1289S probably benign Het
Zfp759 T C 13: 67,139,212 C276R probably damaging Het
Zkscan17 G A 11: 59,487,629 Q243* probably null Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 splice site probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
R7938:Kel UTSW 6 41698376 missense probably benign 0.06
R8028:Kel UTSW 6 41699024 missense probably benign 0.21
R8082:Kel UTSW 6 41703490 missense possibly damaging 0.94
R8465:Kel UTSW 6 41689538 critical splice donor site probably null
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Z1176:Kel UTSW 6 41687572 missense probably damaging 1.00
Z1177:Kel UTSW 6 41689559 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTCCAAAGCAACAAATGATAAGC -3'
(R):5'- GGCTTAGATCACAACATCAGTG -3'

Sequencing Primer
(F):5'- GCAATAAAAGTGGGGATTCATAGTG -3'
(R):5'- TCACAACATCAGTGCAGAGTTG -3'
Posted On2014-06-30