Incidental Mutation 'R1880:Arhgef5'
ID 209031
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor (GEF) 5
Synonyms 2210412D05Rik
MMRRC Submission 039901-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1880 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 43265582-43289320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 43273088 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 258 (Q258K)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect possibly damaging
Transcript: ENSMUST00000031750
AA Change: Q258K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: Q258K

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik C A 19: 29,718,123 L1323F probably benign Het
Afdn A G 17: 13,852,353 D846G possibly damaging Het
Atp10b G T 11: 43,259,432 G1319V probably damaging Het
Axl T C 7: 25,774,548 T315A probably damaging Het
Btnl2 A G 17: 34,365,363 E420G possibly damaging Het
Capn2 A G 1: 182,489,016 W293R probably damaging Het
Cd209f A G 8: 4,105,464 probably null Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Col1a1 A G 11: 94,950,568 K1259R unknown Het
Dpysl3 A T 18: 43,329,874 probably null Het
Dus4l T C 12: 31,640,870 I261V probably benign Het
Ell3 T C 2: 121,440,311 D247G probably benign Het
Erg G A 16: 95,377,309 T246I probably benign Het
Eva1c T C 16: 90,897,415 I196T possibly damaging Het
Fbxo43 T C 15: 36,162,515 D182G probably benign Het
Frrs1 T C 3: 116,896,795 probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gata4 G T 14: 63,204,695 P20Q probably damaging Het
Gm15448 C T 7: 3,824,951 probably null Het
Gmnc T C 16: 26,965,611 D48G probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Habp2 A G 19: 56,317,828 I481V possibly damaging Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Hnrnpul1 A G 7: 25,733,098 V380A possibly damaging Het
Hspa2 G A 12: 76,405,920 D463N possibly damaging Het
Itga11 A G 9: 62,677,949 D2G probably benign Het
Kel G A 6: 41,687,545 L653F possibly damaging Het
Lgr5 T C 10: 115,452,279 Y748C probably damaging Het
Lpxn A G 19: 12,804,088 K57E probably benign Het
Ltbp2 G T 12: 84,829,271 H501N probably benign Het
Macf1 G A 4: 123,438,591 A2419V probably damaging Het
Map3k12 A G 15: 102,502,064 probably null Het
Megf8 G A 7: 25,334,860 V668I possibly damaging Het
Mmp10 T C 9: 7,505,574 S280P probably benign Het
Neb C A 2: 52,258,731 M2601I probably damaging Het
Nsd1 T A 13: 55,213,793 N191K probably damaging Het
Olfr1137 C A 2: 87,711,295 G204C probably damaging Het
Olfr263 A T 13: 21,133,632 N286Y probably damaging Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr807 A G 10: 129,755,421 F10L probably benign Het
Patj C T 4: 98,497,240 P364S probably benign Het
Pex1 T C 5: 3,605,770 V39A probably benign Het
Pkhd1l1 A T 15: 44,525,242 I1332F probably benign Het
Polq T C 16: 37,086,592 V2026A possibly damaging Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Ppp4r4 T A 12: 103,605,035 Y678N possibly damaging Het
Rpf2 T C 10: 40,233,158 D95G possibly damaging Het
Sema3c A T 5: 17,727,466 K656* probably null Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Snap25 G A 2: 136,777,385 V153M probably damaging Het
Snrnp70 T C 7: 45,377,362 probably null Het
Tas2r144 C T 6: 42,216,070 T248I probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Usp38 T C 8: 81,001,066 E346G probably damaging Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r91 A T 7: 20,101,773 S206C probably damaging Het
Vps36 T C 8: 22,213,562 probably null Het
Wdfy3 T C 5: 101,917,435 N1289S probably benign Het
Zfp759 T C 13: 67,139,212 C276R probably damaging Het
Zkscan17 G A 11: 59,487,629 Q243* probably null Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43287624 missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43284006 missense
R9610:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43274802 missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43273593 missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGAAGTGAACTGCTTAGGC -3'
(R):5'- ACTGAGTGGCTACCCTTCTC -3'

Sequencing Primer
(F):5'- CTTAGGCAGGGGAAACAGCTG -3'
(R):5'- ACCTCCCTGGATTCCTGG -3'
Posted On 2014-06-30