Incidental Mutation 'R1880:Megf8'
ID209034
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
MMRRC Submission 039901-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R1880 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25334860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 668 (V668I)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000128119
AA Change: V668I

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: V668I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik C A 19: 29,718,123 L1323F probably benign Het
Afdn A G 17: 13,852,353 D846G possibly damaging Het
Arhgef5 C A 6: 43,273,088 Q258K possibly damaging Het
Atp10b G T 11: 43,259,432 G1319V probably damaging Het
Axl T C 7: 25,774,548 T315A probably damaging Het
Btnl2 A G 17: 34,365,363 E420G possibly damaging Het
Capn2 A G 1: 182,489,016 W293R probably damaging Het
Cd209f A G 8: 4,105,464 probably null Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Col1a1 A G 11: 94,950,568 K1259R unknown Het
Dpysl3 A T 18: 43,329,874 probably null Het
Dus4l T C 12: 31,640,870 I261V probably benign Het
Ell3 T C 2: 121,440,311 D247G probably benign Het
Erg G A 16: 95,377,309 T246I probably benign Het
Eva1c T C 16: 90,897,415 I196T possibly damaging Het
Fbxo43 T C 15: 36,162,515 D182G probably benign Het
Frrs1 T C 3: 116,896,795 probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gata4 G T 14: 63,204,695 P20Q probably damaging Het
Gm15448 C T 7: 3,824,951 probably null Het
Gmnc T C 16: 26,965,611 D48G probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Habp2 A G 19: 56,317,828 I481V possibly damaging Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Hnrnpul1 A G 7: 25,733,098 V380A possibly damaging Het
Hspa2 G A 12: 76,405,920 D463N possibly damaging Het
Itga11 A G 9: 62,677,949 D2G probably benign Het
Kel G A 6: 41,687,545 L653F possibly damaging Het
Lgr5 T C 10: 115,452,279 Y748C probably damaging Het
Lpxn A G 19: 12,804,088 K57E probably benign Het
Ltbp2 G T 12: 84,829,271 H501N probably benign Het
Macf1 G A 4: 123,438,591 A2419V probably damaging Het
Map3k12 A G 15: 102,502,064 probably null Het
Mmp10 T C 9: 7,505,574 S280P probably benign Het
Neb C A 2: 52,258,731 M2601I probably damaging Het
Nsd1 T A 13: 55,213,793 N191K probably damaging Het
Olfr1137 C A 2: 87,711,295 G204C probably damaging Het
Olfr263 A T 13: 21,133,632 N286Y probably damaging Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr807 A G 10: 129,755,421 F10L probably benign Het
Patj C T 4: 98,497,240 P364S probably benign Het
Pex1 T C 5: 3,605,770 V39A probably benign Het
Pkhd1l1 A T 15: 44,525,242 I1332F probably benign Het
Polq T C 16: 37,086,592 V2026A possibly damaging Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Ppp4r4 T A 12: 103,605,035 Y678N possibly damaging Het
Rpf2 T C 10: 40,233,158 D95G possibly damaging Het
Sema3c A T 5: 17,727,466 K656* probably null Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Snap25 G A 2: 136,777,385 V153M probably damaging Het
Snrnp70 T C 7: 45,377,362 probably null Het
Tas2r144 C T 6: 42,216,070 T248I probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Usp38 T C 8: 81,001,066 E346G probably damaging Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r91 A T 7: 20,101,773 S206C probably damaging Het
Vps36 T C 8: 22,213,562 probably null Het
Wdfy3 T C 5: 101,917,435 N1289S probably benign Het
Zfp759 T C 13: 67,139,212 C276R probably damaging Het
Zkscan17 G A 11: 59,487,629 Q243* probably null Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7492:Megf8 UTSW 7 25353848 missense probably benign 0.24
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCTAAGTGACTGCCAAGCATG -3'
(R):5'- ATCCCAGTACTGTCCCCAAG -3'

Sequencing Primer
(F):5'- TGTGCACAATGAGAGCTGCC -3'
(R):5'- TGTCCCCAAGAAAGACTCATTTG -3'
Posted On2014-06-30