Incidental Mutation 'R1880:Snrnp70'
ID209038
Institutional Source Beutler Lab
Gene Symbol Snrnp70
Ensembl Gene ENSMUSG00000063511
Gene Namesmall nuclear ribonucleoprotein 70 (U1)
SynonymsSrnp70, 2700022N21Rik, Rnulp70, Snrp70, U1-70, 3200002N22Rik
MMRRC Submission 039901-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1880 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45376453-45395742 bp(-) (GRCm38)
Type of Mutationintron (33 bp from exon)
DNA Base Change (assembly) T to C at 45377362 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074575] [ENSMUST00000210514] [ENSMUST00000210514] [ENSMUST00000211211] [ENSMUST00000211211]
Predicted Effect probably damaging
Transcript: ENSMUST00000074575
AA Change: D220G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074160
Gene: ENSMUSG00000063511
AA Change: D220G

DomainStartEndE-ValueType
Pfam:U1snRNP70_N 2 94 4e-31 PFAM
RRM 104 177 1.62e-23 SMART
low complexity region 186 203 N/A INTRINSIC
coiled coil region 286 309 N/A INTRINSIC
low complexity region 331 409 N/A INTRINSIC
PDB:3PGW|L 410 448 4e-14 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000209993
Predicted Effect probably null
Transcript: ENSMUST00000210514
Predicted Effect probably null
Transcript: ENSMUST00000210514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211178
Predicted Effect probably null
Transcript: ENSMUST00000211211
Predicted Effect probably null
Transcript: ENSMUST00000211211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211366
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the U1 snRNP (small nuclear ribonucleic particle), one of at least five snRNPs to comprise the spliceosome, which functions in processing of pre-mRNAs. The U1 snRNP has been shown to be important in defining the 5' splice site. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik C A 19: 29,718,123 L1323F probably benign Het
Afdn A G 17: 13,852,353 D846G possibly damaging Het
Arhgef5 C A 6: 43,273,088 Q258K possibly damaging Het
Atp10b G T 11: 43,259,432 G1319V probably damaging Het
Axl T C 7: 25,774,548 T315A probably damaging Het
Btnl2 A G 17: 34,365,363 E420G possibly damaging Het
Capn2 A G 1: 182,489,016 W293R probably damaging Het
Cd209f A G 8: 4,105,464 probably null Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Col1a1 A G 11: 94,950,568 K1259R unknown Het
Dpysl3 A T 18: 43,329,874 probably null Het
Dus4l T C 12: 31,640,870 I261V probably benign Het
Ell3 T C 2: 121,440,311 D247G probably benign Het
Erg G A 16: 95,377,309 T246I probably benign Het
Eva1c T C 16: 90,897,415 I196T possibly damaging Het
Fbxo43 T C 15: 36,162,515 D182G probably benign Het
Frrs1 T C 3: 116,896,795 probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gata4 G T 14: 63,204,695 P20Q probably damaging Het
Gm15448 C T 7: 3,824,951 probably null Het
Gmnc T C 16: 26,965,611 D48G probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Habp2 A G 19: 56,317,828 I481V possibly damaging Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Hnrnpul1 A G 7: 25,733,098 V380A possibly damaging Het
Hspa2 G A 12: 76,405,920 D463N possibly damaging Het
Itga11 A G 9: 62,677,949 D2G probably benign Het
Kel G A 6: 41,687,545 L653F possibly damaging Het
Lgr5 T C 10: 115,452,279 Y748C probably damaging Het
Lpxn A G 19: 12,804,088 K57E probably benign Het
Ltbp2 G T 12: 84,829,271 H501N probably benign Het
Macf1 G A 4: 123,438,591 A2419V probably damaging Het
Map3k12 A G 15: 102,502,064 probably null Het
Megf8 G A 7: 25,334,860 V668I possibly damaging Het
Mmp10 T C 9: 7,505,574 S280P probably benign Het
Neb C A 2: 52,258,731 M2601I probably damaging Het
Nsd1 T A 13: 55,213,793 N191K probably damaging Het
Olfr1137 C A 2: 87,711,295 G204C probably damaging Het
Olfr263 A T 13: 21,133,632 N286Y probably damaging Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr807 A G 10: 129,755,421 F10L probably benign Het
Patj C T 4: 98,497,240 P364S probably benign Het
Pex1 T C 5: 3,605,770 V39A probably benign Het
Pkhd1l1 A T 15: 44,525,242 I1332F probably benign Het
Polq T C 16: 37,086,592 V2026A possibly damaging Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Ppp4r4 T A 12: 103,605,035 Y678N possibly damaging Het
Rpf2 T C 10: 40,233,158 D95G possibly damaging Het
Sema3c A T 5: 17,727,466 K656* probably null Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Snap25 G A 2: 136,777,385 V153M probably damaging Het
Tas2r144 C T 6: 42,216,070 T248I probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Usp38 T C 8: 81,001,066 E346G probably damaging Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r91 A T 7: 20,101,773 S206C probably damaging Het
Vps36 T C 8: 22,213,562 probably null Het
Wdfy3 T C 5: 101,917,435 N1289S probably benign Het
Zfp759 T C 13: 67,139,212 C276R probably damaging Het
Zkscan17 G A 11: 59,487,629 Q243* probably null Het
Other mutations in Snrnp70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Snrnp70 APN 7 45377354 critical splice donor site probably null
IGL01092:Snrnp70 APN 7 45377377 missense probably damaging 0.98
IGL01444:Snrnp70 APN 7 45387236 unclassified probably null
IGL03110:Snrnp70 APN 7 45376859 intron probably benign
R0691:Snrnp70 UTSW 7 45387245 missense possibly damaging 0.60
R1371:Snrnp70 UTSW 7 45380705 unclassified probably benign
R1854:Snrnp70 UTSW 7 45377220 nonsense probably null
R2050:Snrnp70 UTSW 7 45387300 nonsense probably null
R4928:Snrnp70 UTSW 7 45377281 splice site probably null
R5195:Snrnp70 UTSW 7 45394710 missense probably damaging 1.00
R5314:Snrnp70 UTSW 7 45377052 nonsense probably null
R5326:Snrnp70 UTSW 7 45377233 intron probably benign
R5522:Snrnp70 UTSW 7 45377177 intron probably benign
R6182:Snrnp70 UTSW 7 45377073 nonsense probably null
R6739:Snrnp70 UTSW 7 45387419 missense probably damaging 1.00
R7607:Snrnp70 UTSW 7 45392264 missense possibly damaging 0.82
R7789:Snrnp70 UTSW 7 45376621 nonsense probably null
R7840:Snrnp70 UTSW 7 45376790 missense unknown
R7923:Snrnp70 UTSW 7 45376790 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCCTTGTCTCGACTCCGGG -3'
(R):5'- CAGGAGATTATGCCCCATGG -3'

Sequencing Primer
(F):5'- TCCTCCGGTCCCGAGAG -3'
(R):5'- CCCCATGGCAGTTAGTAGGG -3'
Posted On2014-06-30