Mutagenetix > Incidental Mutations

Incidental Mutation 'R0118:Mertk'

20907

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

038404-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R0118 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 128759166 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 357 (R357W)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: R357W

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: R357W

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.8%
3x: 97.2%
10x: 89.3%
20x: 67.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	T	C	9: 30,911,744	R343G	probably damaging	Het
Asxl2	T	G	12: 3,496,923	V569G	probably damaging	Het
Azin2	A	C	4: 128,949,637	H85Q	probably damaging	Het
Cacna1a	C	T	8: 84,536,083	R324C	probably damaging	Het
Ccdc151	A	T	9: 21,995,057	N224K	probably benign	Het
Ccr3	C	A	9: 124,029,610	Y327*	probably null	Het
Cers2	T	C	3: 95,320,226	F55S	probably benign	Het
Cic	C	T	7: 25,286,034	S301L	probably damaging	Het
Cntnap2	T	C	6: 45,060,392		probably null	Het
Cpn2	T	C	16: 30,260,368	R172G	probably benign	Het
Ctdnep1	T	C	11: 69,988,731		probably null	Het
Dennd3	T	A	15: 73,565,076	Y1051N	probably damaging	Het
Dmap1	T	G	4: 117,676,483	Y196S	probably damaging	Het
Entpd7	G	A	19: 43,704,312	W102*	probably null	Het
Frem2	A	T	3: 53,535,243	C2624*	probably null	Het
Gdpd3	A	G	7: 126,770,993	Y238C	probably damaging	Het
Gjb3	A	G	4: 127,326,658	V27A	probably damaging	Het
Kat6b	T	C	14: 21,669,974	F1465L	probably damaging	Het
Klra17	A	T	6: 129,831,589	M227K	probably benign	Het
Map6	A	G	7: 99,317,617	D348G	possibly damaging	Het
Mapkbp1	T	C	2: 120,025,215	S1472P	probably benign	Het
Megf6	C	A	4: 154,254,641	P545Q	probably damaging	Het
Mesd	T	A	7: 83,895,627	I104N	probably damaging	Het
Mrm3	T	A	11: 76,249,955	V263E	possibly damaging	Het
Ndst4	T	A	3: 125,611,561	Y488*	probably null	Het
Nfat5	C	T	8: 107,339,075	R156W	probably damaging	Het
Nfs1	T	C	2: 156,134,524	H150R	probably damaging	Het
Olfr1500	A	G	19: 13,827,565	F277S	possibly damaging	Het
Olfr27	T	A	9: 39,144,103	M1K	probably null	Het
Olfr353	A	G	2: 36,890,023	M275T	probably benign	Het
Olfr923	T	C	9: 38,827,858	S50P	possibly damaging	Het
Pcdh8	T	C	14: 79,767,408	Y1059C	probably damaging	Het
Pik3r5	T	A	11: 68,490,480	L164Q	probably damaging	Het
Polr3g	T	C	13: 81,676,121		probably benign	Het
Ppm1e	T	A	11: 87,231,738	K464N	probably benign	Het
Rims1	T	C	1: 22,346,407	T1037A	probably damaging	Het
Rpgrip1l	A	T	8: 91,270,122	I108N	probably damaging	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Spem1	T	C	11: 69,821,545	K98E	possibly damaging	Het
St7l	T	C	3: 104,889,303	V237A	probably damaging	Het
Tbc1d16	T	C	11: 119,157,816	H337R	probably damaging	Het
Tbc1d32	T	A	10: 56,017,605	I1291F	probably benign	Het
Tnfaip6	G	T	2: 52,043,815	E61*	probably null	Het
Trib2	A	T	12: 15,793,928	W102R	probably damaging	Het
Uimc1	G	T	13: 55,085,644	N66K	probably damaging	Het
Vmn1r63	T	A	7: 5,802,839	T265S	probably benign	Het
Vps35	G	A	8: 85,294,953	T3I	probably benign	Het
Yeats2	T	A	16: 20,156,942	L63*	probably null	Het
Zfp282	A	G	6: 47,892,932	R304G	probably benign	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGCACAGAGGAAGGGCTAC -3'
(R):5'- ACTGGCTTTAAAAGTGTTGCCGC -3'

Sequencing Primer
(F):5'- ACATCTGCGTGCCCAAGTC -3'
(R):5'- cacccgactgctcttcc -3'

Posted On

2013-04-11