Incidental Mutation 'R1881:Usp40'
ID209084
Institutional Source Beutler Lab
Gene Symbol Usp40
Ensembl Gene ENSMUSG00000005501
Gene Nameubiquitin specific peptidase 40
SynonymsB230215L03Rik
MMRRC Submission 039902-MU
Accession Numbers

Genbank: NM_001033291

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1881 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87945119-88008551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87994271 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 290 (D290G)
Ref Sequence ENSEMBL: ENSMUSP00000140107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040783] [ENSMUST00000187758] [ENSMUST00000188332]
Predicted Effect probably benign
Transcript: ENSMUST00000040783
AA Change: D290G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000038533
Gene: ENSMUSG00000005501
AA Change: D290G

DomainStartEndE-ValueType
Pfam:UCH 40 344 1.1e-31 PFAM
Pfam:UCH_1 41 320 1.2e-20 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186315
Predicted Effect probably benign
Transcript: ENSMUST00000187758
AA Change: D290G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140107
Gene: ENSMUSG00000005501
AA Change: D290G

DomainStartEndE-ValueType
Pfam:UCH 40 346 8.7e-41 PFAM
Pfam:UCH_1 41 319 2.4e-22 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188332
SMART Domains Protein: ENSMUSP00000140574
Gene: ENSMUSG00000005501

DomainStartEndE-ValueType
Pfam:UCH 40 70 5.9e-6 PFAM
Meta Mutation Damage Score 0.3823 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,284 D848V probably damaging Het
Acaca C A 11: 84,270,387 Y1026* probably null Het
Acaca T G 11: 84,300,471 probably benign Het
Adcy8 C T 15: 64,806,654 M483I probably damaging Het
Adgrb2 G A 4: 130,010,285 G735S probably damaging Het
Akap9 A G 5: 4,050,173 T2612A probably benign Het
Armc1 A T 3: 19,134,896 S202T possibly damaging Het
Arsj T C 3: 126,438,837 S411P probably damaging Het
Ash1l T C 3: 88,981,555 V247A probably benign Het
Camta2 T C 11: 70,672,016 D935G probably benign Het
Cc2d2a G T 5: 43,740,828 V1626F probably damaging Het
Cpne3 T A 4: 19,535,266 R255S probably benign Het
Cramp1l A G 17: 24,977,682 probably benign Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cstf3 A T 2: 104,654,218 M396L probably benign Het
Ctnnd2 A G 15: 31,005,081 probably benign Het
Cul7 A T 17: 46,651,962 Y173F probably damaging Het
Dach1 A T 14: 97,901,396 M537K probably benign Het
Ddhd2 T C 8: 25,727,700 I717V probably damaging Het
Dnm1 C T 2: 32,323,730 V475I probably damaging Het
Dnm3 C T 1: 162,477,948 probably benign Het
Dsg1c T A 18: 20,272,540 probably benign Het
Eaf2 A T 16: 36,800,579 probably benign Het
En1 T A 1: 120,603,175 V48E unknown Het
Eral1 T A 11: 78,076,049 H180L possibly damaging Het
Fry T A 5: 150,478,046 C2760S probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ifnl2 T A 7: 28,509,687 R68W probably damaging Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Krtap4-1 C T 11: 99,628,164 G7S probably null Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mup5 C A 4: 61,834,631 E52* probably null Het
Myh15 A G 16: 49,071,083 I189V probably damaging Het
Nav3 T A 10: 109,852,559 Q619L probably damaging Het
Olfr298 T C 7: 86,489,438 M38V probably benign Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr59 A T 11: 74,288,666 T7S probably benign Het
Olfr733 A G 14: 50,299,015 I98T probably damaging Het
Pam T C 1: 97,923,151 T161A probably benign Het
Pigs T C 11: 78,341,756 V472A probably benign Het
Plek A T 11: 16,990,111 N176K probably benign Het
Poc5 A G 13: 96,398,731 N168S probably benign Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Rttn T A 18: 89,015,212 S716T probably damaging Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Slc25a20 G A 9: 108,680,209 probably null Het
Slc5a6 A T 5: 31,036,811 L634Q probably damaging Het
Slfn3 A G 11: 83,213,376 I235V possibly damaging Het
Smarcc1 T A 9: 110,175,099 L407Q probably damaging Het
Spata32 T C 11: 103,210,735 probably benign Het
Tdrd3 A G 14: 87,486,347 probably null Het
Thada A G 17: 84,436,702 V726A probably benign Het
Tmed7 A T 18: 46,588,555 probably null Het
Tmem161a G A 8: 70,180,785 G94S probably null Het
Tmem81 T A 1: 132,508,210 probably benign Het
Trim63 C A 4: 134,316,391 A55E probably damaging Het
Trmt1 A C 8: 84,689,267 probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Tshz3 T C 7: 36,771,654 S1023P possibly damaging Het
Upk3bl G A 5: 136,057,303 R31Q probably benign Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r26 T A 6: 58,008,665 T180S probably benign Het
Wdr48 G T 9: 119,909,540 V89L probably benign Het
Wdr6 G T 9: 108,573,179 probably null Het
Zfp345 A G 2: 150,472,355 Y421H probably damaging Het
Other mutations in Usp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Usp40 APN 1 88004238 splice site probably benign
IGL00828:Usp40 APN 1 87978306 unclassified probably benign
IGL01090:Usp40 APN 1 87962465 missense probably benign 0.01
IGL01123:Usp40 APN 1 87986123 missense probably benign 0.01
IGL01401:Usp40 APN 1 87994198 missense probably damaging 1.00
IGL02506:Usp40 APN 1 87982016 missense probably damaging 0.98
IGL02580:Usp40 APN 1 87980966 splice site probably null
IGL02625:Usp40 APN 1 87950017 missense probably benign 0.19
IGL02811:Usp40 APN 1 87995736 missense probably damaging 1.00
IGL02958:Usp40 APN 1 87978485 missense probably damaging 0.99
G5030:Usp40 UTSW 1 87994219 missense probably damaging 1.00
R0019:Usp40 UTSW 1 87978411 missense probably benign 0.00
R0282:Usp40 UTSW 1 87980958 splice site probably benign
R0453:Usp40 UTSW 1 87946598 makesense probably null
R0646:Usp40 UTSW 1 87978522 missense probably benign 0.00
R1440:Usp40 UTSW 1 87982086 missense probably benign 0.01
R1490:Usp40 UTSW 1 87988965 nonsense probably null
R1620:Usp40 UTSW 1 87994225 missense probably damaging 1.00
R1903:Usp40 UTSW 1 87982056 missense probably benign 0.15
R1912:Usp40 UTSW 1 87946646 missense probably benign 0.00
R1919:Usp40 UTSW 1 87995842 missense possibly damaging 0.75
R1976:Usp40 UTSW 1 87978536 missense probably benign 0.00
R2111:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2112:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2163:Usp40 UTSW 1 87995858 splice site probably benign
R2432:Usp40 UTSW 1 87982082 missense probably benign
R2865:Usp40 UTSW 1 87949979 nonsense probably null
R3885:Usp40 UTSW 1 87967269 missense probably damaging 1.00
R4360:Usp40 UTSW 1 87952361 missense probably damaging 1.00
R4370:Usp40 UTSW 1 87997875 missense probably benign
R4496:Usp40 UTSW 1 87995737 missense possibly damaging 0.69
R4714:Usp40 UTSW 1 87967179 splice site probably null
R4888:Usp40 UTSW 1 87986201 critical splice acceptor site probably null
R4944:Usp40 UTSW 1 87952355 missense probably benign 0.10
R5269:Usp40 UTSW 1 87995782 missense probably benign 0.01
R5629:Usp40 UTSW 1 87981009 missense probably benign
R5696:Usp40 UTSW 1 87995752 missense probably benign 0.27
R5756:Usp40 UTSW 1 87951691 missense possibly damaging 0.66
R5887:Usp40 UTSW 1 87999870 missense probably damaging 1.00
R5910:Usp40 UTSW 1 87968400 nonsense probably null
R6014:Usp40 UTSW 1 87980016 missense probably damaging 1.00
R6044:Usp40 UTSW 1 87990150 missense probably benign
R6083:Usp40 UTSW 1 87978559 missense probably benign 0.01
R6299:Usp40 UTSW 1 87997927 missense probably damaging 0.99
R6625:Usp40 UTSW 1 87967213 missense probably benign 0.01
R6757:Usp40 UTSW 1 87980037 missense probably damaging 0.99
R6810:Usp40 UTSW 1 87981033 missense probably benign 0.11
R7110:Usp40 UTSW 1 87986162 missense probably benign 0.11
R7573:Usp40 UTSW 1 87986072 missense probably benign 0.09
R7575:Usp40 UTSW 1 87949960 missense probably damaging 1.00
R7634:Usp40 UTSW 1 87962430 nonsense probably null
R7756:Usp40 UTSW 1 87967200 missense probably damaging 0.99
R7767:Usp40 UTSW 1 87982178 missense probably benign 0.01
R7861:Usp40 UTSW 1 87982130 missense probably damaging 0.99
R7881:Usp40 UTSW 1 87995713 nonsense probably null
R7896:Usp40 UTSW 1 87978479 missense possibly damaging 0.77
R7944:Usp40 UTSW 1 87982130 missense probably damaging 0.99
R7964:Usp40 UTSW 1 87995713 nonsense probably null
R7979:Usp40 UTSW 1 87978479 missense possibly damaging 0.77
RF006:Usp40 UTSW 1 87967195 missense possibly damaging 0.47
Z1177:Usp40 UTSW 1 87968414 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTAAAGGAGGGGTGTATACTGAAG -3'
(R):5'- TTCAACAGCAAAGGGGCCTC -3'

Sequencing Primer
(F):5'- TGTATACTGAAGGCAAAATGAACAAC -3'
(R):5'- CCTCACTGTGAAGTGTGAATGTTTAC -3'
Posted On2014-06-30