Incidental Mutation 'R1881:Wdr48'
ID209122
Institutional Source Beutler Lab
Gene Symbol Wdr48
Ensembl Gene ENSMUSG00000032512
Gene NameWD repeat domain 48
SynonymsUaf1, 8430408H12Rik
MMRRC Submission 039902-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1881 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119894878-119926587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119909540 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 89 (V89L)
Ref Sequence ENSEMBL: ENSMUSP00000149793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036561] [ENSMUST00000177637] [ENSMUST00000215167] [ENSMUST00000215307] [ENSMUST00000217472]
Predicted Effect probably benign
Transcript: ENSMUST00000036561
AA Change: V288L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042509
Gene: ENSMUSG00000032512
AA Change: V288L

DomainStartEndE-ValueType
WD40 14 58 2.88e-1 SMART
WD40 64 103 2.1e-7 SMART
WD40 106 145 1.37e-6 SMART
WD40 157 196 5.39e-5 SMART
WD40 199 238 1.62e-8 SMART
WD40 241 280 4.62e-4 SMART
WD40 350 388 8.84e1 SMART
low complexity region 460 471 N/A INTRINSIC
Pfam:DUF3337 509 673 1.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213230
Predicted Effect probably benign
Transcript: ENSMUST00000215167
AA Change: V89L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000215307
AA Change: V288L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217472
AA Change: V288L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217555
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to interact with ubiquitin specific peptidase 1 (USP1), activating the deubiquitinating activity of USP1 and allowing it to remove the ubiquitin moiety from monoubiquitinated FANCD2. FANCD2 is ubiquitinated in response to DNA damage. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E10.5 with reduced embryonic growth. Mice heterozygous for this allele exhibit reduced weight at birth, skeletal defects and reduced female and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,284 D848V probably damaging Het
Acaca C A 11: 84,270,387 Y1026* probably null Het
Acaca T G 11: 84,300,471 probably benign Het
Adcy8 C T 15: 64,806,654 M483I probably damaging Het
Adgrb2 G A 4: 130,010,285 G735S probably damaging Het
Akap9 A G 5: 4,050,173 T2612A probably benign Het
Armc1 A T 3: 19,134,896 S202T possibly damaging Het
Arsj T C 3: 126,438,837 S411P probably damaging Het
Ash1l T C 3: 88,981,555 V247A probably benign Het
Camta2 T C 11: 70,672,016 D935G probably benign Het
Cc2d2a G T 5: 43,740,828 V1626F probably damaging Het
Cpne3 T A 4: 19,535,266 R255S probably benign Het
Cramp1l A G 17: 24,977,682 probably benign Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cstf3 A T 2: 104,654,218 M396L probably benign Het
Ctnnd2 A G 15: 31,005,081 probably benign Het
Cul7 A T 17: 46,651,962 Y173F probably damaging Het
Dach1 A T 14: 97,901,396 M537K probably benign Het
Ddhd2 T C 8: 25,727,700 I717V probably damaging Het
Dnm1 C T 2: 32,323,730 V475I probably damaging Het
Dnm3 C T 1: 162,477,948 probably benign Het
Dsg1c T A 18: 20,272,540 probably benign Het
Eaf2 A T 16: 36,800,579 probably benign Het
En1 T A 1: 120,603,175 V48E unknown Het
Eral1 T A 11: 78,076,049 H180L possibly damaging Het
Fry T A 5: 150,478,046 C2760S probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ifnl2 T A 7: 28,509,687 R68W probably damaging Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Krtap4-1 C T 11: 99,628,164 G7S probably null Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mup5 C A 4: 61,834,631 E52* probably null Het
Myh15 A G 16: 49,071,083 I189V probably damaging Het
Nav3 T A 10: 109,852,559 Q619L probably damaging Het
Olfr298 T C 7: 86,489,438 M38V probably benign Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr59 A T 11: 74,288,666 T7S probably benign Het
Olfr733 A G 14: 50,299,015 I98T probably damaging Het
Pam T C 1: 97,923,151 T161A probably benign Het
Pigs T C 11: 78,341,756 V472A probably benign Het
Plek A T 11: 16,990,111 N176K probably benign Het
Poc5 A G 13: 96,398,731 N168S probably benign Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Rttn T A 18: 89,015,212 S716T probably damaging Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Slc25a20 G A 9: 108,680,209 probably null Het
Slc5a6 A T 5: 31,036,811 L634Q probably damaging Het
Slfn3 A G 11: 83,213,376 I235V possibly damaging Het
Smarcc1 T A 9: 110,175,099 L407Q probably damaging Het
Spata32 T C 11: 103,210,735 probably benign Het
Tdrd3 A G 14: 87,486,347 probably null Het
Thada A G 17: 84,436,702 V726A probably benign Het
Tmed7 A T 18: 46,588,555 probably null Het
Tmem161a G A 8: 70,180,785 G94S probably null Het
Tmem81 T A 1: 132,508,210 probably benign Het
Trim63 C A 4: 134,316,391 A55E probably damaging Het
Trmt1 A C 8: 84,689,267 probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Tshz3 T C 7: 36,771,654 S1023P possibly damaging Het
Upk3bl G A 5: 136,057,303 R31Q probably benign Het
Usp40 T C 1: 87,994,271 D290G probably benign Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r26 T A 6: 58,008,665 T180S probably benign Het
Wdr6 G T 9: 108,573,179 probably null Het
Zfp345 A G 2: 150,472,355 Y421H probably damaging Het
Other mutations in Wdr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Wdr48 APN 9 119905390 missense probably damaging 1.00
IGL02005:Wdr48 APN 9 119905389 missense probably damaging 1.00
IGL02097:Wdr48 APN 9 119924263 missense probably damaging 1.00
IGL02217:Wdr48 APN 9 119909535 missense probably benign 0.01
IGL02416:Wdr48 APN 9 119924760 missense probably damaging 0.98
IGL03198:Wdr48 APN 9 119912413 missense probably benign 0.01
R0005:Wdr48 UTSW 9 119909434 missense probably benign 0.01
R0109:Wdr48 UTSW 9 119918568 splice site probably benign
R1753:Wdr48 UTSW 9 119924247 nonsense probably null
R1829:Wdr48 UTSW 9 119904330 missense probably benign 0.03
R1837:Wdr48 UTSW 9 119905416 missense probably damaging 0.99
R1916:Wdr48 UTSW 9 119912417 missense probably benign 0.01
R2039:Wdr48 UTSW 9 119909387 missense probably damaging 1.00
R2421:Wdr48 UTSW 9 119902404 missense probably damaging 1.00
R3031:Wdr48 UTSW 9 119924110 missense probably benign 0.02
R3719:Wdr48 UTSW 9 119907131 missense probably damaging 1.00
R6014:Wdr48 UTSW 9 119924709 missense probably damaging 1.00
R6054:Wdr48 UTSW 9 119907777 missense probably damaging 1.00
R6182:Wdr48 UTSW 9 119924766 missense probably damaging 1.00
R6285:Wdr48 UTSW 9 119920610 missense probably damaging 1.00
R6434:Wdr48 UTSW 9 119916813 missense possibly damaging 0.94
R7167:Wdr48 UTSW 9 119907789 critical splice donor site probably null
R7282:Wdr48 UTSW 9 119911081 missense probably damaging 1.00
R7567:Wdr48 UTSW 9 119916828 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGTTCACAGTGCCTCTCTGG -3'
(R):5'- AGAGAGGTACTTCAGATATCACAACG -3'

Sequencing Primer
(F):5'- GGAGTTCTGACGGGACCATTC -3'
(R):5'- CTTCAGATATCACAACGTGTCTAC -3'
Posted On2014-06-30