Mutagenetix > Incidental Mutations

Incidental Mutation 'R1881:Wdr48'

209122

Institutional Source

Beutler Lab

Gene Symbol

Wdr48

Ensembl Gene

ENSMUSG00000032512

Gene Name

WD repeat domain 48

Synonyms

Uaf1, 8430408H12Rik

MMRRC Submission

039902-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1881 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119894878-119926587 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 119909540 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 89 (V89L)

Ref Sequence

ENSEMBL: ENSMUSP00000149793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036561] [ENSMUST00000177637] [ENSMUST00000215167] [ENSMUST00000215307] [ENSMUST00000217472]

Predicted Effect

probably benign
Transcript: ENSMUST00000036561
AA Change: V288L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000042509
Gene: ENSMUSG00000032512
AA Change: V288L

Domain	Start	End	E-Value	Type
WD40	14	58	2.88e-1	SMART
WD40	64	103	2.1e-7	SMART
WD40	106	145	1.37e-6	SMART
WD40	157	196	5.39e-5	SMART
WD40	199	238	1.62e-8	SMART
WD40	241	280	4.62e-4	SMART
WD40	350	388	8.84e1	SMART
low complexity region	460	471	N/A	INTRINSIC
Pfam:DUF3337	509	673	1.1e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177637

SMART Domains

Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

Domain	Start	End	E-Value	Type
Pfam:7tm_1	49	294	3.5e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213230

Predicted Effect

probably benign
Transcript: ENSMUST00000215167
AA Change: V89L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000215307
AA Change: V288L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000217472
AA Change: V288L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217555

Meta Mutation Damage Score

0.0697

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 95.1%
20x: 92.3%

Validation Efficiency

96% (71/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to interact with ubiquitin specific peptidase 1 (USP1), activating the deubiquitinating activity of USP1 and allowing it to remove the ubiquitin moiety from monoubiquitinated FANCD2. FANCD2 is ubiquitinated in response to DNA damage. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E10.5 with reduced embryonic growth. Mice heterozygous for this allele exhibit reduced weight at birth, skeletal defects and reduced female and male fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,065,284	D848V	probably damaging	Het
Acaca	C	A	11: 84,270,387	Y1026*	probably null	Het
Acaca	T	G	11: 84,300,471		probably benign	Het
Adcy8	C	T	15: 64,806,654	M483I	probably damaging	Het
Adgrb2	G	A	4: 130,010,285	G735S	probably damaging	Het
Akap9	A	G	5: 4,050,173	T2612A	probably benign	Het
Armc1	A	T	3: 19,134,896	S202T	possibly damaging	Het
Arsj	T	C	3: 126,438,837	S411P	probably damaging	Het
Ash1l	T	C	3: 88,981,555	V247A	probably benign	Het
Camta2	T	C	11: 70,672,016	D935G	probably benign	Het
Cc2d2a	G	T	5: 43,740,828	V1626F	probably damaging	Het
Cpne3	T	A	4: 19,535,266	R255S	probably benign	Het
Cramp1l	A	G	17: 24,977,682		probably benign	Het
Csf2rb2	C	T	15: 78,292,535		probably null	Het
Cstf3	A	T	2: 104,654,218	M396L	probably benign	Het
Ctnnd2	A	G	15: 31,005,081		probably benign	Het
Cul7	A	T	17: 46,651,962	Y173F	probably damaging	Het
Dach1	A	T	14: 97,901,396	M537K	probably benign	Het
Ddhd2	T	C	8: 25,727,700	I717V	probably damaging	Het
Dnm1	C	T	2: 32,323,730	V475I	probably damaging	Het
Dnm3	C	T	1: 162,477,948		probably benign	Het
Dsg1c	T	A	18: 20,272,540		probably benign	Het
Eaf2	A	T	16: 36,800,579		probably benign	Het
En1	T	A	1: 120,603,175	V48E	unknown	Het
Eral1	T	A	11: 78,076,049	H180L	possibly damaging	Het
Fry	T	A	5: 150,478,046	C2760S	probably damaging	Het
Gtf2h3	C	T	5: 124,584,273	A113V	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ifnl2	T	A	7: 28,509,687	R68W	probably damaging	Het
Il6st	A	G	13: 112,504,413	T908A	probably damaging	Het
Krtap4-1	C	T	11: 99,628,164	G7S	probably null	Het
Ly75	T	C	2: 60,349,940	E631G	probably benign	Het
Mup5	C	A	4: 61,834,631	E52*	probably null	Het
Myh15	A	G	16: 49,071,083	I189V	probably damaging	Het
Nav3	T	A	10: 109,852,559	Q619L	probably damaging	Het
Olfr298	T	C	7: 86,489,438	M38V	probably benign	Het
Olfr513	T	C	7: 108,755,128	S91P	probably damaging	Het
Olfr59	A	T	11: 74,288,666	T7S	probably benign	Het
Olfr733	A	G	14: 50,299,015	I98T	probably damaging	Het
Pam	T	C	1: 97,923,151	T161A	probably benign	Het
Pigs	T	C	11: 78,341,756	V472A	probably benign	Het
Plek	A	T	11: 16,990,111	N176K	probably benign	Het
Poc5	A	G	13: 96,398,731	N168S	probably benign	Het
Pomt2	G	T	12: 87,135,596	A219D	probably damaging	Het
Rttn	T	A	18: 89,015,212	S716T	probably damaging	Het
Sema4b	A	T	7: 80,216,792	S207C	probably damaging	Het
Slc25a20	G	A	9: 108,680,209		probably null	Het
Slc5a6	A	T	5: 31,036,811	L634Q	probably damaging	Het
Slfn3	A	G	11: 83,213,376	I235V	possibly damaging	Het
Smarcc1	T	A	9: 110,175,099	L407Q	probably damaging	Het
Spata32	T	C	11: 103,210,735		probably benign	Het
Tdrd3	A	G	14: 87,486,347		probably null	Het
Thada	A	G	17: 84,436,702	V726A	probably benign	Het
Tmed7	A	T	18: 46,588,555		probably null	Het
Tmem161a	G	A	8: 70,180,785	G94S	probably null	Het
Tmem81	T	A	1: 132,508,210		probably benign	Het
Trim63	C	A	4: 134,316,391	A55E	probably damaging	Het
Trmt1	A	C	8: 84,689,267		probably benign	Het
Trpv4	C	T	5: 114,623,626	V814M	probably benign	Het
Tshz3	T	C	7: 36,771,654	S1023P	possibly damaging	Het
Upk3bl	G	A	5: 136,057,303	R31Q	probably benign	Het
Usp40	T	C	1: 87,994,271	D290G	probably benign	Het
Vmn1r192	G	T	13: 22,187,594	A152E	probably benign	Het
Vmn1r26	T	A	6: 58,008,665	T180S	probably benign	Het
Wdr6	G	T	9: 108,573,179		probably null	Het
Zfp345	A	G	2: 150,472,355	Y421H	probably damaging	Het

Other mutations in Wdr48

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Wdr48	APN	9	119905390	missense	probably damaging	1.00
IGL02005:Wdr48	APN	9	119905389	missense	probably damaging	1.00
IGL02097:Wdr48	APN	9	119924263	missense	probably damaging	1.00
IGL02217:Wdr48	APN	9	119909535	missense	probably benign	0.01
IGL02416:Wdr48	APN	9	119924760	missense	probably damaging	0.98
IGL03198:Wdr48	APN	9	119912413	missense	probably benign	0.01
R0005:Wdr48	UTSW	9	119909434	missense	probably benign	0.01
R0109:Wdr48	UTSW	9	119918568	splice site	probably benign
R1753:Wdr48	UTSW	9	119924247	nonsense	probably null
R1829:Wdr48	UTSW	9	119904330	missense	probably benign	0.03
R1837:Wdr48	UTSW	9	119905416	missense	probably damaging	0.99
R1916:Wdr48	UTSW	9	119912417	missense	probably benign	0.01
R2039:Wdr48	UTSW	9	119909387	missense	probably damaging	1.00
R2421:Wdr48	UTSW	9	119902404	missense	probably damaging	1.00
R3031:Wdr48	UTSW	9	119924110	missense	probably benign	0.02
R3719:Wdr48	UTSW	9	119907131	missense	probably damaging	1.00
R6014:Wdr48	UTSW	9	119924709	missense	probably damaging	1.00
R6054:Wdr48	UTSW	9	119907777	missense	probably damaging	1.00
R6182:Wdr48	UTSW	9	119924766	missense	probably damaging	1.00
R6285:Wdr48	UTSW	9	119920610	missense	probably damaging	1.00
R6434:Wdr48	UTSW	9	119916813	missense	possibly damaging	0.94
R7167:Wdr48	UTSW	9	119907789	critical splice donor site	probably null
R7282:Wdr48	UTSW	9	119911081	missense	probably damaging	1.00
R7567:Wdr48	UTSW	9	119916828	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- TGTTCACAGTGCCTCTCTGG -3'
(R):5'- AGAGAGGTACTTCAGATATCACAACG -3'

Sequencing Primer
(F):5'- GGAGTTCTGACGGGACCATTC -3'
(R):5'- CTTCAGATATCACAACGTGTCTAC -3'

Posted On

2014-06-30