Incidental Mutation 'R1881:Pigs'
ID209128
Institutional Source Beutler Lab
Gene Symbol Pigs
Ensembl Gene ENSMUSG00000041958
Gene Namephosphatidylinositol glycan anchor biosynthesis, class S
SynonymsLOC245087, LOC276846
MMRRC Submission 039902-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R1881 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78328415-78342782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78341756 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 472 (V472A)
Ref Sequence ENSEMBL: ENSMUSP00000044871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002127] [ENSMUST00000048073] [ENSMUST00000100755] [ENSMUST00000108295]
Predicted Effect probably benign
Transcript: ENSMUST00000002127
SMART Domains Protein: ENSMUSP00000002127
Gene: ENSMUSG00000002058

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 78 237 1.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048073
AA Change: V472A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000044871
Gene: ENSMUSG00000041958
AA Change: V472A

DomainStartEndE-ValueType
Pfam:PIG-S 22 547 3.3e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100755
SMART Domains Protein: ENSMUSP00000098318
Gene: ENSMUSG00000002058

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 13 172 1.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108295
SMART Domains Protein: ENSMUSP00000103930
Gene: ENSMUSG00000002058

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 80 212 1.3e-60 PFAM
Pfam:GMP_PDE_delta 218 258 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154700
Meta Mutation Damage Score 0.2017 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,284 D848V probably damaging Het
Acaca C A 11: 84,270,387 Y1026* probably null Het
Acaca T G 11: 84,300,471 probably benign Het
Adcy8 C T 15: 64,806,654 M483I probably damaging Het
Adgrb2 G A 4: 130,010,285 G735S probably damaging Het
Akap9 A G 5: 4,050,173 T2612A probably benign Het
Armc1 A T 3: 19,134,896 S202T possibly damaging Het
Arsj T C 3: 126,438,837 S411P probably damaging Het
Ash1l T C 3: 88,981,555 V247A probably benign Het
Camta2 T C 11: 70,672,016 D935G probably benign Het
Cc2d2a G T 5: 43,740,828 V1626F probably damaging Het
Cpne3 T A 4: 19,535,266 R255S probably benign Het
Cramp1l A G 17: 24,977,682 probably benign Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cstf3 A T 2: 104,654,218 M396L probably benign Het
Ctnnd2 A G 15: 31,005,081 probably benign Het
Cul7 A T 17: 46,651,962 Y173F probably damaging Het
Dach1 A T 14: 97,901,396 M537K probably benign Het
Ddhd2 T C 8: 25,727,700 I717V probably damaging Het
Dnm1 C T 2: 32,323,730 V475I probably damaging Het
Dnm3 C T 1: 162,477,948 probably benign Het
Dsg1c T A 18: 20,272,540 probably benign Het
Eaf2 A T 16: 36,800,579 probably benign Het
En1 T A 1: 120,603,175 V48E unknown Het
Eral1 T A 11: 78,076,049 H180L possibly damaging Het
Fry T A 5: 150,478,046 C2760S probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ifnl2 T A 7: 28,509,687 R68W probably damaging Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Krtap4-1 C T 11: 99,628,164 G7S probably null Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mup5 C A 4: 61,834,631 E52* probably null Het
Myh15 A G 16: 49,071,083 I189V probably damaging Het
Nav3 T A 10: 109,852,559 Q619L probably damaging Het
Olfr298 T C 7: 86,489,438 M38V probably benign Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr59 A T 11: 74,288,666 T7S probably benign Het
Olfr733 A G 14: 50,299,015 I98T probably damaging Het
Pam T C 1: 97,923,151 T161A probably benign Het
Plek A T 11: 16,990,111 N176K probably benign Het
Poc5 A G 13: 96,398,731 N168S probably benign Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Rttn T A 18: 89,015,212 S716T probably damaging Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Slc25a20 G A 9: 108,680,209 probably null Het
Slc5a6 A T 5: 31,036,811 L634Q probably damaging Het
Slfn3 A G 11: 83,213,376 I235V possibly damaging Het
Smarcc1 T A 9: 110,175,099 L407Q probably damaging Het
Spata32 T C 11: 103,210,735 probably benign Het
Tdrd3 A G 14: 87,486,347 probably null Het
Thada A G 17: 84,436,702 V726A probably benign Het
Tmed7 A T 18: 46,588,555 probably null Het
Tmem161a G A 8: 70,180,785 G94S probably null Het
Tmem81 T A 1: 132,508,210 probably benign Het
Trim63 C A 4: 134,316,391 A55E probably damaging Het
Trmt1 A C 8: 84,689,267 probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Tshz3 T C 7: 36,771,654 S1023P possibly damaging Het
Upk3bl G A 5: 136,057,303 R31Q probably benign Het
Usp40 T C 1: 87,994,271 D290G probably benign Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r26 T A 6: 58,008,665 T180S probably benign Het
Wdr48 G T 9: 119,909,540 V89L probably benign Het
Wdr6 G T 9: 108,573,179 probably null Het
Zfp345 A G 2: 150,472,355 Y421H probably damaging Het
Other mutations in Pigs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Pigs APN 11 78340031 missense probably benign
feral UTSW 11 78336739 missense possibly damaging 0.94
R0094:Pigs UTSW 11 78340038 missense probably damaging 0.98
R0490:Pigs UTSW 11 78335625 missense probably damaging 1.00
R1027:Pigs UTSW 11 78336825 missense probably damaging 1.00
R1073:Pigs UTSW 11 78335605 missense probably benign 0.09
R1157:Pigs UTSW 11 78328994 missense possibly damaging 0.87
R1754:Pigs UTSW 11 78337847 missense probably damaging 0.99
R2171:Pigs UTSW 11 78328812 missense probably damaging 1.00
R2386:Pigs UTSW 11 78332986 missense probably damaging 1.00
R4928:Pigs UTSW 11 78329002 missense probably damaging 0.99
R5206:Pigs UTSW 11 78333723 missense probably damaging 0.98
R5480:Pigs UTSW 11 78329075 missense possibly damaging 0.58
R5665:Pigs UTSW 11 78328769 synonymous probably null
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6159:Pigs UTSW 11 78328500 missense probably benign 0.01
R6572:Pigs UTSW 11 78339364 missense probably damaging 0.98
R6618:Pigs UTSW 11 78341230 missense probably damaging 1.00
R7052:Pigs UTSW 11 78341385 missense probably damaging 1.00
R7065:Pigs UTSW 11 78336739 missense possibly damaging 0.94
R7352:Pigs UTSW 11 78328812 missense probably damaging 1.00
R7851:Pigs UTSW 11 78336787 missense probably damaging 1.00
R7934:Pigs UTSW 11 78336787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCAAGCTGCCCCTCAG -3'
(R):5'- TCTTAACCAGGGACAGGAGG -3'

Sequencing Primer
(F):5'- TCAGAAAATAAACAACAGCTGTGTC -3'
(R):5'- CAGGAGGATGGGCACAGC -3'
Posted On2014-06-30