Incidental Mutation 'R1881:Ctnnd2'
ID209143
Institutional Source Beutler Lab
Gene Symbol Ctnnd2
Ensembl Gene ENSMUSG00000022240
Gene Namecatenin (cadherin associated protein), delta 2
SynonymsCatnd2, neurojugin, Nprap
MMRRC Submission 039902-MU
Accession Numbers

NCBI RefSeq: NM_008729.2; MGI:1195966

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1881 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location30172593-31029341 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 31005081 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081728] [ENSMUST00000226119]
Predicted Effect probably benign
Transcript: ENSMUST00000081728
SMART Domains Protein: ENSMUSP00000080427
Gene: ENSMUSG00000022240

DomainStartEndE-ValueType
coiled coil region 50 84 N/A INTRINSIC
low complexity region 87 97 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
ARM 577 617 1.85e-8 SMART
ARM 621 662 1.15e-9 SMART
ARM 663 720 1.51e1 SMART
ARM 722 769 2.74e1 SMART
ARM 830 871 4.88e0 SMART
ARM 902 942 2.76e-7 SMART
low complexity region 964 973 N/A INTRINSIC
ARM 995 1039 5.64e-4 SMART
low complexity region 1086 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227029
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 96% (71/74)
MGI Phenotype Strain: 3056606
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesive junction associated protein of the armadillo/beta-catenin superfamily and is implicated in brain and eye development and cancer formation. The protein encoded by this gene promotes the disruption of E-cadherin based adherens junction to favor cell spreading upon stimulation by hepatocyte growth factor. This gene is overexpressed in prostate adenocarcinomas and is associated with decreased expression of tumor suppressor E-cadherin in this tissue. This gene resides in a region of the short arm of chromosome 5 that is deleted in Cri du Chat syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal conditioning, spatial learning and coordination behaviors and abnormal long term potentiation. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,284 D848V probably damaging Het
Acaca C A 11: 84,270,387 Y1026* probably null Het
Acaca T G 11: 84,300,471 probably benign Het
Adcy8 C T 15: 64,806,654 M483I probably damaging Het
Adgrb2 G A 4: 130,010,285 G735S probably damaging Het
Akap9 A G 5: 4,050,173 T2612A probably benign Het
Armc1 A T 3: 19,134,896 S202T possibly damaging Het
Arsj T C 3: 126,438,837 S411P probably damaging Het
Ash1l T C 3: 88,981,555 V247A probably benign Het
Camta2 T C 11: 70,672,016 D935G probably benign Het
Cc2d2a G T 5: 43,740,828 V1626F probably damaging Het
Cpne3 T A 4: 19,535,266 R255S probably benign Het
Cramp1l A G 17: 24,977,682 probably benign Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cstf3 A T 2: 104,654,218 M396L probably benign Het
Cul7 A T 17: 46,651,962 Y173F probably damaging Het
Dach1 A T 14: 97,901,396 M537K probably benign Het
Ddhd2 T C 8: 25,727,700 I717V probably damaging Het
Dnm1 C T 2: 32,323,730 V475I probably damaging Het
Dnm3 C T 1: 162,477,948 probably benign Het
Dsg1c T A 18: 20,272,540 probably benign Het
Eaf2 A T 16: 36,800,579 probably benign Het
En1 T A 1: 120,603,175 V48E unknown Het
Eral1 T A 11: 78,076,049 H180L possibly damaging Het
Fry T A 5: 150,478,046 C2760S probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ifnl2 T A 7: 28,509,687 R68W probably damaging Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Krtap4-1 C T 11: 99,628,164 G7S probably null Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mup5 C A 4: 61,834,631 E52* probably null Het
Myh15 A G 16: 49,071,083 I189V probably damaging Het
Nav3 T A 10: 109,852,559 Q619L probably damaging Het
Olfr298 T C 7: 86,489,438 M38V probably benign Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr59 A T 11: 74,288,666 T7S probably benign Het
Olfr733 A G 14: 50,299,015 I98T probably damaging Het
Pam T C 1: 97,923,151 T161A probably benign Het
Pigs T C 11: 78,341,756 V472A probably benign Het
Plek A T 11: 16,990,111 N176K probably benign Het
Poc5 A G 13: 96,398,731 N168S probably benign Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Rttn T A 18: 89,015,212 S716T probably damaging Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Slc25a20 G A 9: 108,680,209 probably null Het
Slc5a6 A T 5: 31,036,811 L634Q probably damaging Het
Slfn3 A G 11: 83,213,376 I235V possibly damaging Het
Smarcc1 T A 9: 110,175,099 L407Q probably damaging Het
Spata32 T C 11: 103,210,735 probably benign Het
Tdrd3 A G 14: 87,486,347 probably null Het
Thada A G 17: 84,436,702 V726A probably benign Het
Tmed7 A T 18: 46,588,555 probably null Het
Tmem161a G A 8: 70,180,785 G94S probably null Het
Tmem81 T A 1: 132,508,210 probably benign Het
Trim63 C A 4: 134,316,391 A55E probably damaging Het
Trmt1 A C 8: 84,689,267 probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Tshz3 T C 7: 36,771,654 S1023P possibly damaging Het
Upk3bl G A 5: 136,057,303 R31Q probably benign Het
Usp40 T C 1: 87,994,271 D290G probably benign Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r26 T A 6: 58,008,665 T180S probably benign Het
Wdr48 G T 9: 119,909,540 V89L probably benign Het
Wdr6 G T 9: 108,573,179 probably null Het
Zfp345 A G 2: 150,472,355 Y421H probably damaging Het
Other mutations in Ctnnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Ctnnd2 APN 15 30647141 missense possibly damaging 0.73
IGL01612:Ctnnd2 APN 15 31005018 missense probably damaging 1.00
IGL01923:Ctnnd2 APN 15 30480828 missense probably damaging 0.99
IGL02183:Ctnnd2 APN 15 31020740 missense probably damaging 1.00
IGL02186:Ctnnd2 APN 15 30480793 missense probably damaging 0.99
IGL02226:Ctnnd2 APN 15 30847336 missense probably benign 0.01
IGL02307:Ctnnd2 APN 15 30647211 missense possibly damaging 0.86
IGL02407:Ctnnd2 APN 15 30966768 missense probably damaging 1.00
IGL02474:Ctnnd2 APN 15 30669562 missense possibly damaging 0.71
IGL02718:Ctnnd2 APN 15 31027616 missense probably damaging 1.00
IGL03249:Ctnnd2 APN 15 30683236 missense probably benign 0.45
IGL03328:Ctnnd2 APN 15 30921847 splice site probably benign
carpe UTSW 15 30905820 missense probably damaging 1.00
diem UTSW 15 30683347 missense possibly damaging 0.85
P0016:Ctnnd2 UTSW 15 30966938 missense probably benign 0.00
R0130:Ctnnd2 UTSW 15 30921913 missense probably damaging 1.00
R0408:Ctnnd2 UTSW 15 30634677 missense probably damaging 1.00
R0611:Ctnnd2 UTSW 15 31009084 missense possibly damaging 0.75
R0894:Ctnnd2 UTSW 15 30332155 splice site probably benign
R1112:Ctnnd2 UTSW 15 30921880 missense probably damaging 1.00
R1459:Ctnnd2 UTSW 15 30847299 missense probably damaging 1.00
R1529:Ctnnd2 UTSW 15 30887121 missense possibly damaging 0.91
R1532:Ctnnd2 UTSW 15 30921868 missense probably damaging 1.00
R1701:Ctnnd2 UTSW 15 30921981 missense probably damaging 1.00
R1807:Ctnnd2 UTSW 15 30619871 missense probably damaging 1.00
R1960:Ctnnd2 UTSW 15 30647111 missense probably damaging 0.96
R2121:Ctnnd2 UTSW 15 30669514 missense probably damaging 1.00
R3839:Ctnnd2 UTSW 15 31009028 splice site probably null
R3967:Ctnnd2 UTSW 15 30646929 missense possibly damaging 0.81
R3980:Ctnnd2 UTSW 15 30669443 missense probably benign 0.14
R4207:Ctnnd2 UTSW 15 30972827 missense probably damaging 0.99
R4279:Ctnnd2 UTSW 15 30905820 missense probably damaging 1.00
R4498:Ctnnd2 UTSW 15 30619874 missense probably damaging 1.00
R4622:Ctnnd2 UTSW 15 30887169 missense probably benign 0.17
R4622:Ctnnd2 UTSW 15 31009113 missense probably benign 0.00
R4860:Ctnnd2 UTSW 15 30881167 missense probably damaging 1.00
R4860:Ctnnd2 UTSW 15 30881167 missense probably damaging 1.00
R4979:Ctnnd2 UTSW 15 31009075 missense probably damaging 1.00
R5086:Ctnnd2 UTSW 15 30683347 missense possibly damaging 0.85
R5330:Ctnnd2 UTSW 15 30332115 missense probably damaging 1.00
R5459:Ctnnd2 UTSW 15 30887188 missense probably damaging 1.00
R5595:Ctnnd2 UTSW 15 30669543 missense probably benign 0.07
R5809:Ctnnd2 UTSW 15 30847377 missense probably damaging 1.00
R5987:Ctnnd2 UTSW 15 30683241 missense probably benign
R6245:Ctnnd2 UTSW 15 30905748 missense probably damaging 1.00
R6379:Ctnnd2 UTSW 15 30634698 missense probably damaging 1.00
R6737:Ctnnd2 UTSW 15 30966834 nonsense probably null
R6979:Ctnnd2 UTSW 15 30619230 missense probably damaging 0.99
R7133:Ctnnd2 UTSW 15 30480849 missense possibly damaging 0.47
R7179:Ctnnd2 UTSW 15 30683364 missense possibly damaging 0.95
R7267:Ctnnd2 UTSW 15 30683355 missense probably benign 0.13
R7275:Ctnnd2 UTSW 15 30905709 missense possibly damaging 0.94
R7386:Ctnnd2 UTSW 15 30966768 missense probably damaging 1.00
R7649:Ctnnd2 UTSW 15 31027484 missense probably benign 0.11
Z1088:Ctnnd2 UTSW 15 30966813 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GCAAATTCAAATGCTTGGAACTCC -3'
(R):5'- TTCCTCACTGAGTGCAGGAC -3'

Sequencing Primer
(F):5'- ACTCCACCGAGTCAGGAG -3'
(R):5'- GGACACATCCCACAGACGGAAG -3'
Posted On2014-06-30