Incidental Mutation 'R1881:4921501E09Rik'
ID209150
Institutional Source Beutler Lab
Gene Symbol 4921501E09Rik
Ensembl Gene ENSMUSG00000023350
Gene NameRIKEN cDNA 4921501E09 gene
Synonyms
MMRRC Submission 039902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1881 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33064143-33068058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33065284 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 848 (D848V)
Ref Sequence ENSEMBL: ENSMUSP00000024121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024121]
Predicted Effect probably damaging
Transcript: ENSMUST00000024121
AA Change: D848V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024121
Gene: ENSMUSG00000023350
AA Change: D848V

DomainStartEndE-ValueType
PHD 7 54 1.5e-8 SMART
JmjC 195 351 1.38e-46 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
Meta Mutation Damage Score 0.2379 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca C A 11: 84,270,387 Y1026* probably null Het
Acaca T G 11: 84,300,471 probably benign Het
Adcy8 C T 15: 64,806,654 M483I probably damaging Het
Adgrb2 G A 4: 130,010,285 G735S probably damaging Het
Akap9 A G 5: 4,050,173 T2612A probably benign Het
Armc1 A T 3: 19,134,896 S202T possibly damaging Het
Arsj T C 3: 126,438,837 S411P probably damaging Het
Ash1l T C 3: 88,981,555 V247A probably benign Het
Camta2 T C 11: 70,672,016 D935G probably benign Het
Cc2d2a G T 5: 43,740,828 V1626F probably damaging Het
Cpne3 T A 4: 19,535,266 R255S probably benign Het
Cramp1l A G 17: 24,977,682 probably benign Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cstf3 A T 2: 104,654,218 M396L probably benign Het
Ctnnd2 A G 15: 31,005,081 probably benign Het
Cul7 A T 17: 46,651,962 Y173F probably damaging Het
Dach1 A T 14: 97,901,396 M537K probably benign Het
Ddhd2 T C 8: 25,727,700 I717V probably damaging Het
Dnm1 C T 2: 32,323,730 V475I probably damaging Het
Dnm3 C T 1: 162,477,948 probably benign Het
Dsg1c T A 18: 20,272,540 probably benign Het
Eaf2 A T 16: 36,800,579 probably benign Het
En1 T A 1: 120,603,175 V48E unknown Het
Eral1 T A 11: 78,076,049 H180L possibly damaging Het
Fry T A 5: 150,478,046 C2760S probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ifnl2 T A 7: 28,509,687 R68W probably damaging Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Krtap4-1 C T 11: 99,628,164 G7S probably null Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mup5 C A 4: 61,834,631 E52* probably null Het
Myh15 A G 16: 49,071,083 I189V probably damaging Het
Nav3 T A 10: 109,852,559 Q619L probably damaging Het
Olfr298 T C 7: 86,489,438 M38V probably benign Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr59 A T 11: 74,288,666 T7S probably benign Het
Olfr733 A G 14: 50,299,015 I98T probably damaging Het
Pam T C 1: 97,923,151 T161A probably benign Het
Pigs T C 11: 78,341,756 V472A probably benign Het
Plek A T 11: 16,990,111 N176K probably benign Het
Poc5 A G 13: 96,398,731 N168S probably benign Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Rttn T A 18: 89,015,212 S716T probably damaging Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Slc25a20 G A 9: 108,680,209 probably null Het
Slc5a6 A T 5: 31,036,811 L634Q probably damaging Het
Slfn3 A G 11: 83,213,376 I235V possibly damaging Het
Smarcc1 T A 9: 110,175,099 L407Q probably damaging Het
Spata32 T C 11: 103,210,735 probably benign Het
Tdrd3 A G 14: 87,486,347 probably null Het
Thada A G 17: 84,436,702 V726A probably benign Het
Tmed7 A T 18: 46,588,555 probably null Het
Tmem161a G A 8: 70,180,785 G94S probably null Het
Tmem81 T A 1: 132,508,210 probably benign Het
Trim63 C A 4: 134,316,391 A55E probably damaging Het
Trmt1 A C 8: 84,689,267 probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Tshz3 T C 7: 36,771,654 S1023P possibly damaging Het
Upk3bl G A 5: 136,057,303 R31Q probably benign Het
Usp40 T C 1: 87,994,271 D290G probably benign Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r26 T A 6: 58,008,665 T180S probably benign Het
Wdr48 G T 9: 119,909,540 V89L probably benign Het
Wdr6 G T 9: 108,573,179 probably null Het
Zfp345 A G 2: 150,472,355 Y421H probably damaging Het
Other mutations in 4921501E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:4921501E09Rik APN 17 33065863 missense probably benign 0.10
IGL00790:4921501E09Rik APN 17 33067387 missense probably damaging 1.00
IGL01146:4921501E09Rik APN 17 33065383 missense possibly damaging 0.68
IGL01755:4921501E09Rik APN 17 33066977 missense probably damaging 0.99
IGL01880:4921501E09Rik APN 17 33066716 missense probably damaging 0.99
IGL01981:4921501E09Rik APN 17 33067654 missense probably damaging 1.00
IGL01982:4921501E09Rik APN 17 33066315 missense probably benign 0.00
IGL02047:4921501E09Rik APN 17 33067301 missense probably damaging 1.00
IGL02070:4921501E09Rik APN 17 33066130 missense probably damaging 0.98
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0893:4921501E09Rik UTSW 17 33065289 missense probably benign 0.34
R1528:4921501E09Rik UTSW 17 33067241 missense probably damaging 1.00
R1558:4921501E09Rik UTSW 17 33065705 missense probably benign 0.20
R1664:4921501E09Rik UTSW 17 33066518 missense probably damaging 1.00
R1782:4921501E09Rik UTSW 17 33067688 missense probably benign 0.06
R2018:4921501E09Rik UTSW 17 33066967 missense probably benign 0.15
R2029:4921501E09Rik UTSW 17 33067624 nonsense probably null
R2152:4921501E09Rik UTSW 17 33066934 missense probably damaging 1.00
R2298:4921501E09Rik UTSW 17 33066778 missense probably damaging 1.00
R2395:4921501E09Rik UTSW 17 33065962 missense probably benign 0.28
R2424:4921501E09Rik UTSW 17 33065756 missense probably benign 0.00
R3973:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R3976:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R4159:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4160:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4161:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4761:4921501E09Rik UTSW 17 33067198 missense probably damaging 1.00
R4855:4921501E09Rik UTSW 17 33066739 missense probably benign 0.00
R5039:4921501E09Rik UTSW 17 33067760 missense probably damaging 1.00
R5255:4921501E09Rik UTSW 17 33066765 nonsense probably null
R5383:4921501E09Rik UTSW 17 33065257 missense probably benign
R5520:4921501E09Rik UTSW 17 33065393 missense probably benign 0.03
R5588:4921501E09Rik UTSW 17 33066275 nonsense probably null
R5685:4921501E09Rik UTSW 17 33066772 missense probably benign 0.04
R5826:4921501E09Rik UTSW 17 33065314 missense possibly damaging 0.87
R5907:4921501E09Rik UTSW 17 33066150 missense probably benign 0.01
R6397:4921501E09Rik UTSW 17 33066245 missense probably benign 0.28
R6731:4921501E09Rik UTSW 17 33066226 missense probably benign 0.02
R6750:4921501E09Rik UTSW 17 33066398 missense possibly damaging 0.82
R7043:4921501E09Rik UTSW 17 33065332 missense possibly damaging 0.85
R7242:4921501E09Rik UTSW 17 33067127 missense probably damaging 1.00
R7262:4921501E09Rik UTSW 17 33066997 missense probably damaging 0.99
R7265:4921501E09Rik UTSW 17 33066997 missense probably damaging 0.99
R7286:4921501E09Rik UTSW 17 33065527 missense probably benign
R7797:4921501E09Rik UTSW 17 33067690 missense probably damaging 1.00
Z1176:4921501E09Rik UTSW 17 33065657 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCCTGGACTAGTGAGAGTGAGC -3'
(R):5'- AGTCCTGTTTCTCGGCGTAC -3'

Sequencing Primer
(F):5'- AGAGTGAGCTTCATGTTGTTCACC -3'
(R):5'- TCGGCGTACCCCAAGGAAATG -3'
Posted On2014-06-30