Incidental Mutation 'R1881:Thada'
ID209152
Institutional Source Beutler Lab
Gene Symbol Thada
Ensembl Gene ENSMUSG00000024251
Gene Namethyroid adenoma associated
Synonyms
MMRRC Submission 039902-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1881 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84190056-84466196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84436702 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 726 (V726A)
Ref Sequence ENSEMBL: ENSMUSP00000041701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524]
Predicted Effect probably benign
Transcript: ENSMUST00000047524
AA Change: V726A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251
AA Change: V726A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,284 D848V probably damaging Het
Acaca C A 11: 84,270,387 Y1026* probably null Het
Acaca T G 11: 84,300,471 probably benign Het
Adcy8 C T 15: 64,806,654 M483I probably damaging Het
Adgrb2 G A 4: 130,010,285 G735S probably damaging Het
Akap9 A G 5: 4,050,173 T2612A probably benign Het
Armc1 A T 3: 19,134,896 S202T possibly damaging Het
Arsj T C 3: 126,438,837 S411P probably damaging Het
Ash1l T C 3: 88,981,555 V247A probably benign Het
Camta2 T C 11: 70,672,016 D935G probably benign Het
Cc2d2a G T 5: 43,740,828 V1626F probably damaging Het
Cpne3 T A 4: 19,535,266 R255S probably benign Het
Cramp1l A G 17: 24,977,682 probably benign Het
Csf2rb2 C T 15: 78,292,535 probably null Het
Cstf3 A T 2: 104,654,218 M396L probably benign Het
Ctnnd2 A G 15: 31,005,081 probably benign Het
Cul7 A T 17: 46,651,962 Y173F probably damaging Het
Dach1 A T 14: 97,901,396 M537K probably benign Het
Ddhd2 T C 8: 25,727,700 I717V probably damaging Het
Dnm1 C T 2: 32,323,730 V475I probably damaging Het
Dnm3 C T 1: 162,477,948 probably benign Het
Dsg1c T A 18: 20,272,540 probably benign Het
Eaf2 A T 16: 36,800,579 probably benign Het
En1 T A 1: 120,603,175 V48E unknown Het
Eral1 T A 11: 78,076,049 H180L possibly damaging Het
Fry T A 5: 150,478,046 C2760S probably damaging Het
Gtf2h3 C T 5: 124,584,273 A113V probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ifnl2 T A 7: 28,509,687 R68W probably damaging Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Krtap4-1 C T 11: 99,628,164 G7S probably null Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mup5 C A 4: 61,834,631 E52* probably null Het
Myh15 A G 16: 49,071,083 I189V probably damaging Het
Nav3 T A 10: 109,852,559 Q619L probably damaging Het
Olfr298 T C 7: 86,489,438 M38V probably benign Het
Olfr513 T C 7: 108,755,128 S91P probably damaging Het
Olfr59 A T 11: 74,288,666 T7S probably benign Het
Olfr733 A G 14: 50,299,015 I98T probably damaging Het
Pam T C 1: 97,923,151 T161A probably benign Het
Pigs T C 11: 78,341,756 V472A probably benign Het
Plek A T 11: 16,990,111 N176K probably benign Het
Poc5 A G 13: 96,398,731 N168S probably benign Het
Pomt2 G T 12: 87,135,596 A219D probably damaging Het
Rttn T A 18: 89,015,212 S716T probably damaging Het
Sema4b A T 7: 80,216,792 S207C probably damaging Het
Slc25a20 G A 9: 108,680,209 probably null Het
Slc5a6 A T 5: 31,036,811 L634Q probably damaging Het
Slfn3 A G 11: 83,213,376 I235V possibly damaging Het
Smarcc1 T A 9: 110,175,099 L407Q probably damaging Het
Spata32 T C 11: 103,210,735 probably benign Het
Tdrd3 A G 14: 87,486,347 probably null Het
Tmed7 A T 18: 46,588,555 probably null Het
Tmem161a G A 8: 70,180,785 G94S probably null Het
Tmem81 T A 1: 132,508,210 probably benign Het
Trim63 C A 4: 134,316,391 A55E probably damaging Het
Trmt1 A C 8: 84,689,267 probably benign Het
Trpv4 C T 5: 114,623,626 V814M probably benign Het
Tshz3 T C 7: 36,771,654 S1023P possibly damaging Het
Upk3bl G A 5: 136,057,303 R31Q probably benign Het
Usp40 T C 1: 87,994,271 D290G probably benign Het
Vmn1r192 G T 13: 22,187,594 A152E probably benign Het
Vmn1r26 T A 6: 58,008,665 T180S probably benign Het
Wdr48 G T 9: 119,909,540 V89L probably benign Het
Wdr6 G T 9: 108,573,179 probably null Het
Zfp345 A G 2: 150,472,355 Y421H probably damaging Het
Other mutations in Thada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Thada APN 17 84444218 missense probably benign 0.01
IGL00902:Thada APN 17 84447976 missense probably damaging 1.00
IGL01634:Thada APN 17 84393358 critical splice donor site probably null
IGL01689:Thada APN 17 84446688 missense possibly damaging 0.80
IGL01693:Thada APN 17 84446644 missense probably benign
IGL01937:Thada APN 17 84222766 missense probably benign 0.00
IGL01945:Thada APN 17 84222766 missense probably benign 0.00
IGL02231:Thada APN 17 84428697 missense probably damaging 1.00
IGL02951:Thada APN 17 84444028 missense probably benign 0.16
IGL03167:Thada APN 17 84458849 missense probably damaging 0.97
IGL03279:Thada APN 17 84435560 missense probably benign 0.01
IGL03347:Thada APN 17 84398205 missense probably damaging 1.00
H8562:Thada UTSW 17 84446544 missense probably damaging 1.00
IGL03098:Thada UTSW 17 84334141 missense possibly damaging 0.93
R0006:Thada UTSW 17 84226040 missense probably benign 0.00
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0357:Thada UTSW 17 84230936 missense probably damaging 1.00
R0388:Thada UTSW 17 84231096 missense probably benign 0.00
R0543:Thada UTSW 17 84423163 missense probably damaging 1.00
R0606:Thada UTSW 17 84416303 missense possibly damaging 0.90
R0630:Thada UTSW 17 84229175 missense probably damaging 1.00
R0664:Thada UTSW 17 84336829 missense probably damaging 1.00
R0855:Thada UTSW 17 84436655 missense probably damaging 1.00
R0972:Thada UTSW 17 84429062 splice site probably benign
R1297:Thada UTSW 17 84252435 splice site probably benign
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1490:Thada UTSW 17 84446601 missense possibly damaging 0.68
R1789:Thada UTSW 17 84448033 missense probably damaging 1.00
R1789:Thada UTSW 17 84448034 missense probably damaging 1.00
R1802:Thada UTSW 17 84464407 missense probably benign 0.34
R1831:Thada UTSW 17 84231114 missense probably damaging 0.97
R1834:Thada UTSW 17 84226004 missense possibly damaging 0.53
R1925:Thada UTSW 17 84444499 missense probably benign 0.05
R1969:Thada UTSW 17 84310042 missense probably damaging 1.00
R1970:Thada UTSW 17 84310042 missense probably damaging 1.00
R1971:Thada UTSW 17 84310042 missense probably damaging 1.00
R2149:Thada UTSW 17 84441764 missense probably damaging 1.00
R2191:Thada UTSW 17 84446521 missense probably benign 0.00
R2571:Thada UTSW 17 84454640 missense probably damaging 0.99
R3405:Thada UTSW 17 84230785 splice site probably benign
R3406:Thada UTSW 17 84230785 splice site probably benign
R3916:Thada UTSW 17 84441782 missense possibly damaging 0.92
R4044:Thada UTSW 17 84441707 missense probably benign 0.41
R4461:Thada UTSW 17 84426237 missense probably damaging 1.00
R4662:Thada UTSW 17 84435650 missense probably damaging 1.00
R4696:Thada UTSW 17 84426186 missense possibly damaging 0.83
R4786:Thada UTSW 17 84458855 missense possibly damaging 0.66
R4803:Thada UTSW 17 84272817 missense probably damaging 0.96
R4835:Thada UTSW 17 84441104 splice site probably null
R4872:Thada UTSW 17 84446599 missense probably damaging 1.00
R4898:Thada UTSW 17 84448042 splice site probably null
R4903:Thada UTSW 17 84252400 missense possibly damaging 0.67
R4929:Thada UTSW 17 84444226 missense probably benign 0.01
R4959:Thada UTSW 17 84444183 missense probably damaging 1.00
R5071:Thada UTSW 17 84386532 missense probably damaging 1.00
R5092:Thada UTSW 17 84444468 missense probably damaging 0.97
R5398:Thada UTSW 17 84426186 missense probably benign 0.03
R5480:Thada UTSW 17 84432254 missense probably benign 0.00
R5552:Thada UTSW 17 84429130 missense probably benign 0.03
R5575:Thada UTSW 17 84416399 splice site probably null
R5623:Thada UTSW 17 84191983 missense probably benign 0.00
R5688:Thada UTSW 17 84451727 missense probably benign 0.00
R5704:Thada UTSW 17 84230901 missense probably benign 0.01
R6008:Thada UTSW 17 84436634 missense probably damaging 1.00
R6013:Thada UTSW 17 84272800 missense probably benign 0.00
R6072:Thada UTSW 17 84192006 missense possibly damaging 0.93
R6156:Thada UTSW 17 84393367 missense probably damaging 0.98
R6243:Thada UTSW 17 84436602 missense probably benign 0.01
R6449:Thada UTSW 17 84429173 missense probably benign
R6453:Thada UTSW 17 84416323 missense probably damaging 1.00
R6474:Thada UTSW 17 84443911 missense possibly damaging 0.83
R6732:Thada UTSW 17 84454414 intron probably null
R6907:Thada UTSW 17 84393469 missense probably damaging 1.00
R7117:Thada UTSW 17 84230786 splice site probably null
R7167:Thada UTSW 17 84230963 missense probably benign
R7221:Thada UTSW 17 84464366 missense possibly damaging 0.46
R7470:Thada UTSW 17 84226041 missense probably benign
R7753:Thada UTSW 17 84252390 missense probably damaging 1.00
R7809:Thada UTSW 17 84451837 missense possibly damaging 0.80
R7882:Thada UTSW 17 84429196 missense possibly damaging 0.85
R7965:Thada UTSW 17 84429196 missense possibly damaging 0.85
R8004:Thada UTSW 17 84192205 missense probably benign
R8153:Thada UTSW 17 84393427 missense possibly damaging 0.90
Z1176:Thada UTSW 17 84444430 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AACAGGAGGAGACAGCTCTCTC -3'
(R):5'- CTGTAGGAGGTGTCAAGCTG -3'

Sequencing Primer
(F):5'- GGAGGAGACAGCTCTCTCTCTCTC -3'
(R):5'- AGGTGTCAAGCTGAAGAGTC -3'
Posted On2014-06-30