Incidental Mutation 'R1882:Nlrp4d'
ID209177
Institutional Source Beutler Lab
Gene Symbol Nlrp4d
Ensembl Gene ENSMUSG00000034122
Gene NameNLR family, pyrin domain containing 4D
SynonymsNalp4d, Nalp-beta
MMRRC Submission 039903-MU
Accession Numbers

Genbank: XM_001481310; Ensembl: ENSMUST00000184509

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1882 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10358862-10388935 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 10382677 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000083450
Gene: ENSMUSG00000034122

DomainStartEndE-ValueType
PYRIN 6 89 2.6e-31 SMART
Pfam:NACHT 150 318 2.4e-34 PFAM
low complexity region 575 586 N/A INTRINSIC
LRR 674 701 1.3e-1 SMART
Blast:LRR 703 729 8e-7 BLAST
LRR 730 756 2.1e-2 SMART
LRR 758 785 2.1e-1 SMART
LRR 786 813 1.6e-5 SMART
LRR 814 837 3.5e-1 SMART
LRR 838 865 2.7e-6 SMART
LRR 867 894 7.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182420
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,798,506 S189P probably benign Het
Adgrg3 G T 8: 95,040,315 V433F probably benign Het
Arhgap33 A T 7: 30,522,809 W1233R probably damaging Het
Brf2 T C 8: 27,128,549 D9G probably damaging Het
Btrc G A 19: 45,527,400 R562Q probably damaging Het
Cenpu T C 8: 46,556,190 F67L probably damaging Het
Chia1 T C 3: 106,128,474 M150T probably damaging Het
Cntln A G 4: 85,100,835 E1254G probably damaging Het
Creld1 G A 6: 113,492,205 C332Y probably damaging Het
Ctla2a A G 13: 60,935,541 probably benign Het
Dusp13 A T 14: 21,734,975 D223E probably benign Het
Ext1 C A 15: 53,075,792 L620F probably damaging Het
Gm6614 C A 6: 141,993,637 probably null Het
H2-DMb2 C T 17: 34,147,860 R89C probably damaging Het
Klhl32 A T 4: 24,743,916 L17* probably null Het
Lats2 C T 14: 57,697,354 V640M probably damaging Het
Lrig3 G A 10: 126,009,825 V708I possibly damaging Het
Mtcl1 T C 17: 66,379,320 T415A probably benign Het
Mynn A G 3: 30,616,813 *611W probably null Het
Nfx1 A G 4: 41,009,240 T793A possibly damaging Het
Nos3 T C 5: 24,368,820 V194A probably damaging Het
Npc1l1 C T 11: 6,217,473 probably null Het
Nrg2 T C 18: 36,021,097 D589G probably damaging Het
Olfr1008 T A 2: 85,689,606 M59K probably damaging Het
Olfr126 T C 17: 37,850,948 S119P probably damaging Het
Olfr1390 A G 11: 49,340,712 Y60C probably damaging Het
Olfr1418 T C 19: 11,855,471 T161A probably damaging Het
Omg C T 11: 79,501,719 probably benign Het
P2ry2 G T 7: 100,998,851 Y82* probably null Het
Pcdh1 T C 18: 38,202,842 T247A possibly damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pgm3 A G 9: 86,565,690 Y167H possibly damaging Het
Pramef20 A T 4: 144,376,915 C214S probably benign Het
Prmt2 T C 10: 76,222,468 H169R probably benign Het
Rad51ap2 T A 12: 11,456,250 S58T possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Slc6a15 T C 10: 103,395,064 S217P probably benign Het
Snx27 G A 3: 94,519,109 T361I probably damaging Het
St7l A G 3: 104,868,047 T80A probably damaging Het
Stk32b T A 5: 37,531,687 M98L possibly damaging Het
Tonsl C A 15: 76,624,150 A6S possibly damaging Het
Tpx2 A G 2: 152,869,691 R49G probably benign Het
Trmt2a A G 16: 18,249,894 K144E possibly damaging Het
Trpm7 A C 2: 126,812,777 L1414V probably benign Het
Ugdh T C 5: 65,423,596 K107E possibly damaging Het
Vamp3 A T 4: 151,050,909 probably benign Het
Vmn1r172 T C 7: 23,660,226 S179P probably damaging Het
Vmn1r28 A G 6: 58,265,978 M269V probably benign Het
Vmn2r94 T C 17: 18,244,214 T605A probably benign Het
Vwce A G 19: 10,638,156 T134A possibly damaging Het
Zfp277 T C 12: 40,445,746 E5G probably benign Het
Other mutations in Nlrp4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Nlrp4d APN 7 10382094 exon noncoding transcript
IGL01076:Nlrp4d APN 7 10372083 missense unknown 0.00
IGL01656:Nlrp4d APN 7 10364147 missense noncoding transcript
IGL01889:Nlrp4d APN 7 10378334 missense unknown 0.00
IGL02110:Nlrp4d APN 7 10382564 exon noncoding transcript
IGL02271:Nlrp4d APN 7 10388698 exon noncoding transcript
IGL02637:Nlrp4d APN 7 10382555 exon noncoding transcript
snoop UTSW 7 10374891 missense probably benign 0.02
1mM(1):Nlrp4d UTSW 7 10381713 missense probably benign 0.09
F5493:Nlrp4d UTSW 7 10381084 missense possibly damaging 0.84
IGL03048:Nlrp4d UTSW 7 10358954 unclassified noncoding transcript
R0116:Nlrp4d UTSW 7 10374891 missense probably benign 0.02
R0125:Nlrp4d UTSW 7 10382389 missense probably damaging 1.00
R0390:Nlrp4d UTSW 7 10388778 missense probably benign 0.04
R0452:Nlrp4d UTSW 7 10378292 missense probably benign 0.01
R0595:Nlrp4d UTSW 7 10381045 missense probably benign 0.00
R0729:Nlrp4d UTSW 7 10377685 critical splice donor site probably benign
R0733:Nlrp4d UTSW 7 10382522 missense probably benign 0.02
R1147:Nlrp4d UTSW 7 10388717 missense probably benign 0.00
R1217:Nlrp4d UTSW 7 10364267 missense probably benign 0.36
R1378:Nlrp4d UTSW 7 10364184 missense probably benign 0.23
R1414:Nlrp4d UTSW 7 10382601 missense probably benign 0.22
R1583:Nlrp4d UTSW 7 10382237 missense probably damaging 0.99
R1585:Nlrp4d UTSW 7 10382510 missense probably benign 0.02
R2422:Nlrp4d UTSW 7 10362945 missense probably benign 0.29
R2907:Nlrp4d UTSW 7 10378427 missense probably benign 0.00
R2964:Nlrp4d UTSW 7 10378329 nonsense probably null
R2974:Nlrp4d UTSW 7 10378440 critical splice acceptor site probably benign
R3401:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R3402:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R4240:Nlrp4d UTSW 7 10381316 missense noncoding transcript
R4682:Nlrp4d UTSW 7 10374952 missense noncoding transcript
R4766:Nlrp4d UTSW 7 10362779 critical splice donor site unknown
R4864:Nlrp4d UTSW 7 10381161 missense noncoding transcript
R4910:Nlrp4d UTSW 7 10378409 exon noncoding transcript
R5307:Nlrp4d UTSW 7 10362782 nonsense probably null
R5596:Nlrp4d UTSW 7 10382024 missense noncoding transcript
R5857:Nlrp4d UTSW 7 10382377 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- CACGTGTGGCTTCATTTCAG -3'
(R):5'- TGGGCCCACAGCTTACAAAC -3'

Sequencing Primer
(F):5'- CAGTTCTCTTTGATAGGAAAAGGTC -3'
(R):5'- GAGTACCTGAGGTTAACTCCCAG -3'
Posted On2014-06-30