Incidental Mutation 'R1882:Vmn1r172'
ID209178
Institutional Source Beutler Lab
Gene Symbol Vmn1r172
Ensembl Gene ENSMUSG00000035523
Gene Namevomeronasal 1 receptor 172
SynonymsV1rd9, V3R9
MMRRC Submission 039903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1882 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23658316-23668447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23660226 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 179 (S179P)
Ref Sequence ENSEMBL: ENSMUSP00000133887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038694] [ENSMUST00000173101]
Predicted Effect probably damaging
Transcript: ENSMUST00000038694
AA Change: S179P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041653
Gene: ENSMUSG00000035523
AA Change: S179P

DomainStartEndE-ValueType
Pfam:TAS2R 8 301 7.1e-9 PFAM
Pfam:7tm_1 30 268 3.6e-9 PFAM
Pfam:V1R 43 301 7.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173101
AA Change: S179P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133887
Gene: ENSMUSG00000035523
AA Change: S179P

DomainStartEndE-ValueType
Pfam:TAS2R 8 301 7.2e-9 PFAM
Pfam:V1R 43 301 7.2e-18 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,798,506 S189P probably benign Het
Adgrg3 G T 8: 95,040,315 V433F probably benign Het
Arhgap33 A T 7: 30,522,809 W1233R probably damaging Het
Brf2 T C 8: 27,128,549 D9G probably damaging Het
Btrc G A 19: 45,527,400 R562Q probably damaging Het
Cenpu T C 8: 46,556,190 F67L probably damaging Het
Chia1 T C 3: 106,128,474 M150T probably damaging Het
Cntln A G 4: 85,100,835 E1254G probably damaging Het
Creld1 G A 6: 113,492,205 C332Y probably damaging Het
Ctla2a A G 13: 60,935,541 probably benign Het
Dusp13 A T 14: 21,734,975 D223E probably benign Het
Ext1 C A 15: 53,075,792 L620F probably damaging Het
Gm6614 C A 6: 141,993,637 probably null Het
H2-DMb2 C T 17: 34,147,860 R89C probably damaging Het
Klhl32 A T 4: 24,743,916 L17* probably null Het
Lats2 C T 14: 57,697,354 V640M probably damaging Het
Lrig3 G A 10: 126,009,825 V708I possibly damaging Het
Mtcl1 T C 17: 66,379,320 T415A probably benign Het
Mynn A G 3: 30,616,813 *611W probably null Het
Nfx1 A G 4: 41,009,240 T793A possibly damaging Het
Nlrp4d T C 7: 10,382,677 noncoding transcript Het
Nos3 T C 5: 24,368,820 V194A probably damaging Het
Npc1l1 C T 11: 6,217,473 probably null Het
Nrg2 T C 18: 36,021,097 D589G probably damaging Het
Olfr1008 T A 2: 85,689,606 M59K probably damaging Het
Olfr126 T C 17: 37,850,948 S119P probably damaging Het
Olfr1390 A G 11: 49,340,712 Y60C probably damaging Het
Olfr1418 T C 19: 11,855,471 T161A probably damaging Het
Omg C T 11: 79,501,719 probably benign Het
P2ry2 G T 7: 100,998,851 Y82* probably null Het
Pcdh1 T C 18: 38,202,842 T247A possibly damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pgm3 A G 9: 86,565,690 Y167H possibly damaging Het
Pramef20 A T 4: 144,376,915 C214S probably benign Het
Prmt2 T C 10: 76,222,468 H169R probably benign Het
Rad51ap2 T A 12: 11,456,250 S58T possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Slc6a15 T C 10: 103,395,064 S217P probably benign Het
Snx27 G A 3: 94,519,109 T361I probably damaging Het
St7l A G 3: 104,868,047 T80A probably damaging Het
Stk32b T A 5: 37,531,687 M98L possibly damaging Het
Tonsl C A 15: 76,624,150 A6S possibly damaging Het
Tpx2 A G 2: 152,869,691 R49G probably benign Het
Trmt2a A G 16: 18,249,894 K144E possibly damaging Het
Trpm7 A C 2: 126,812,777 L1414V probably benign Het
Ugdh T C 5: 65,423,596 K107E possibly damaging Het
Vamp3 A T 4: 151,050,909 probably benign Het
Vmn1r28 A G 6: 58,265,978 M269V probably benign Het
Vmn2r94 T C 17: 18,244,214 T605A probably benign Het
Vwce A G 19: 10,638,156 T134A possibly damaging Het
Zfp277 T C 12: 40,445,746 E5G probably benign Het
Other mutations in Vmn1r172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Vmn1r172 APN 7 23659917 missense probably benign 0.30
IGL02407:Vmn1r172 APN 7 23659803 missense probably damaging 1.00
IGL02540:Vmn1r172 APN 7 23659925 missense probably benign 0.25
IGL03090:Vmn1r172 APN 7 23660038 missense probably damaging 0.98
R0396:Vmn1r172 UTSW 7 23660532 missense probably benign 0.06
R1087:Vmn1r172 UTSW 7 23660248 missense possibly damaging 0.92
R1502:Vmn1r172 UTSW 7 23660256 nonsense probably null
R1701:Vmn1r172 UTSW 7 23660104 missense probably damaging 1.00
R2272:Vmn1r172 UTSW 7 23660191 missense probably damaging 0.98
R4646:Vmn1r172 UTSW 7 23660494 missense probably benign 0.03
R4653:Vmn1r172 UTSW 7 23660572 missense probably damaging 0.96
R4709:Vmn1r172 UTSW 7 23660181 missense probably benign 0.25
R4937:Vmn1r172 UTSW 7 23659887 missense possibly damaging 0.92
R4945:Vmn1r172 UTSW 7 23660320 missense possibly damaging 0.79
R5840:Vmn1r172 UTSW 7 23660175 missense probably benign 0.03
R6154:Vmn1r172 UTSW 7 23660158 missense probably damaging 0.96
R6317:Vmn1r172 UTSW 7 23660317 missense probably damaging 1.00
R7206:Vmn1r172 UTSW 7 23660157 missense possibly damaging 0.69
R7290:Vmn1r172 UTSW 7 23660623 missense unknown
R7362:Vmn1r172 UTSW 7 23660416 missense probably damaging 1.00
R7369:Vmn1r172 UTSW 7 23660605 missense unknown
R7528:Vmn1r172 UTSW 7 23659764 missense probably damaging 1.00
U24488:Vmn1r172 UTSW 7 23659746 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAACATGTGTACTACTTGTGTCCTG -3'
(R):5'- TCTGGCCTCTGGTTGAAGTC -3'

Sequencing Primer
(F):5'- GTGTCCTGAGCACTTACCAG -3'
(R):5'- TCTGGTTGAAGTCCCAGGCTC -3'
Posted On2014-06-30