Mutagenetix > Incidental Mutation

Incidental Mutation 'R1882:Ext1'

209202

Institutional Source

Beutler Lab

Gene Symbol

Ext1

Ensembl Gene

ENSMUSG00000061731

Gene Name

exostoses (multiple) 1

Synonyms

MMRRC Submission

039903-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1882 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53064038-53346159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 53075792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 620 (L620F)

Ref Sequence

ENSEMBL: ENSMUSP00000076505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]

AlphaFold

P97464

Predicted Effect

probably damaging
Transcript: ENSMUST00000077273
AA Change: L620F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: L620F

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
low complexity region	29	41	N/A	INTRINSIC
Pfam:Exostosin	110	396	6e-64	PFAM
Pfam:Glyco_transf_64	480	729	1.1e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133362

Meta Mutation Damage Score

0.9505

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.6%
20x: 93.5%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	T	C	19: 43,798,506	S189P	probably benign	Het
Adgrg3	G	T	8: 95,040,315	V433F	probably benign	Het
Arhgap33	A	T	7: 30,522,809	W1233R	probably damaging	Het
Brf2	T	C	8: 27,128,549	D9G	probably damaging	Het
Btrc	G	A	19: 45,527,400	R562Q	probably damaging	Het
Cenpu	T	C	8: 46,556,190	F67L	probably damaging	Het
Chia1	T	C	3: 106,128,474	M150T	probably damaging	Het
Cntln	A	G	4: 85,100,835	E1254G	probably damaging	Het
Creld1	G	A	6: 113,492,205	C332Y	probably damaging	Het
Ctla2a	A	G	13: 60,935,541		probably benign	Het
Dusp13	A	T	14: 21,734,975	D223E	probably benign	Het
Gm6614	C	A	6: 141,993,637		probably null	Het
H2-DMb2	C	T	17: 34,147,860	R89C	probably damaging	Het
Klhl32	A	T	4: 24,743,916	L17*	probably null	Het
Lats2	C	T	14: 57,697,354	V640M	probably damaging	Het
Lrig3	G	A	10: 126,009,825	V708I	possibly damaging	Het
Mtcl1	T	C	17: 66,379,320	T415A	probably benign	Het
Mynn	A	G	3: 30,616,813	*611W	probably null	Het
Nfx1	A	G	4: 41,009,240	T793A	possibly damaging	Het
Nlrp4d	T	C	7: 10,382,677		noncoding transcript	Het
Nos3	T	C	5: 24,368,820	V194A	probably damaging	Het
Npc1l1	C	T	11: 6,217,473		probably null	Het
Nrg2	T	C	18: 36,021,097	D589G	probably damaging	Het
Olfr1008	T	A	2: 85,689,606	M59K	probably damaging	Het
Olfr126	T	C	17: 37,850,948	S119P	probably damaging	Het
Olfr1390	A	G	11: 49,340,712	Y60C	probably damaging	Het
Olfr1418	T	C	19: 11,855,471	T161A	probably damaging	Het
Omg	C	T	11: 79,501,719		probably benign	Het
P2ry2	G	T	7: 100,998,851	Y82*	probably null	Het
Pcdh1	T	C	18: 38,202,842	T247A	possibly damaging	Het
Pecr	A	T	1: 72,274,977		probably null	Het
Pgm3	A	G	9: 86,565,690	Y167H	possibly damaging	Het
Pramef20	A	T	4: 144,376,915	C214S	probably benign	Het
Prmt2	T	C	10: 76,222,468	H169R	probably benign	Het
Rad51ap2	T	A	12: 11,456,250	S58T	possibly damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Slc6a15	T	C	10: 103,395,064	S217P	probably benign	Het
Snx27	G	A	3: 94,519,109	T361I	probably damaging	Het
St7l	A	G	3: 104,868,047	T80A	probably damaging	Het
Stk32b	T	A	5: 37,531,687	M98L	possibly damaging	Het
Tonsl	C	A	15: 76,624,150	A6S	possibly damaging	Het
Tpx2	A	G	2: 152,869,691	R49G	probably benign	Het
Trmt2a	A	G	16: 18,249,894	K144E	possibly damaging	Het
Trpm7	A	C	2: 126,812,777	L1414V	probably benign	Het
Ugdh	T	C	5: 65,423,596	K107E	possibly damaging	Het
Vamp3	A	T	4: 151,050,909		probably benign	Het
Vmn1r172	T	C	7: 23,660,226	S179P	probably damaging	Het
Vmn1r28	A	G	6: 58,265,978	M269V	probably benign	Het
Vmn2r94	T	C	17: 18,244,214	T605A	probably benign	Het
Vwce	A	G	19: 10,638,156	T134A	possibly damaging	Het
Zfp277	T	C	12: 40,445,746	E5G	probably benign	Het

Other mutations in Ext1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Ext1	APN	15	53344873	missense	probably damaging	1.00
IGL02081:Ext1	APN	15	53073446	nonsense	probably null
IGL03147:Ext1	UTSW	15	53088072	missense	probably damaging	0.98
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0437:Ext1	UTSW	15	53106106	missense	probably damaging	1.00
R0881:Ext1	UTSW	15	53344483	missense	probably benign	0.23
R2135:Ext1	UTSW	15	53101744	missense	possibly damaging	0.88
R2175:Ext1	UTSW	15	53068728	missense	probably damaging	1.00
R2762:Ext1	UTSW	15	53344927	missense	probably benign	0.29
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3752:Ext1	UTSW	15	53075910	missense	probably damaging	1.00
R3815:Ext1	UTSW	15	53345089	missense	probably benign	0.05
R4096:Ext1	UTSW	15	53073357	missense	probably damaging	1.00
R4298:Ext1	UTSW	15	53345125	missense	probably benign	0.02
R4362:Ext1	UTSW	15	53107591	intron	probably benign
R4550:Ext1	UTSW	15	53101786	missense	probably damaging	0.99
R4647:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4648:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4871:Ext1	UTSW	15	53092377	missense	probably benign	0.37
R4954:Ext1	UTSW	15	53344492	missense	probably damaging	1.00
R5010:Ext1	UTSW	15	53092412	missense	probably damaging	1.00
R5153:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5155:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5328:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5385:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5542:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5555:Ext1	UTSW	15	53088143	missense	probably damaging	1.00
R5779:Ext1	UTSW	15	53344553	missense	probably damaging	0.99
R5874:Ext1	UTSW	15	53101752	missense	possibly damaging	0.61
R6401:Ext1	UTSW	15	53106097	missense	possibly damaging	0.94
R6604:Ext1	UTSW	15	53083159	missense	probably damaging	0.99
R6847:Ext1	UTSW	15	53345154	missense	probably benign
R6885:Ext1	UTSW	15	53101692	missense	probably damaging	1.00
R7212:Ext1	UTSW	15	53345162	missense	probably benign	0.00
R7315:Ext1	UTSW	15	53073387	missense	probably damaging	1.00
R7361:Ext1	UTSW	15	53344723	missense	probably damaging	1.00
R7474:Ext1	UTSW	15	53344489	missense	probably damaging	0.98
R7853:Ext1	UTSW	15	53107485	missense	probably damaging	0.96
R7860:Ext1	UTSW	15	53089939	missense	possibly damaging	0.84
R8013:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8014:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8725:Ext1	UTSW	15	53344669	missense	possibly damaging	0.91
R8888:Ext1	UTSW	15	53092327	missense	probably damaging	1.00
R9162:Ext1	UTSW	15	53345108	nonsense	probably null
R9342:Ext1	UTSW	15	53345128	missense	probably benign
R9587:Ext1	UTSW	15	53092412	missense	possibly damaging	0.53
R9663:Ext1	UTSW	15	53345060	missense	probably damaging	0.96
R9753:Ext1	UTSW	15	53344671	missense	probably damaging	1.00
X0021:Ext1	UTSW	15	53345273	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCAGTTGTTAGAAATCTCAGCTC -3'
(R):5'- CGAAACAGTTGTGGGACTCC -3'

Sequencing Primer
(F):5'- TGTTAGAAATCTCAGCTCCGGGC -3'
(R):5'- GGGACTCCACGTTATGAATTAGC -3'

Posted On

2014-06-30