Incidental Mutation 'R1882:Abcc2'
ID 209215
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonyms multidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission 039903-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1882 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 43782192-43840740 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43798506 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 189 (S189P)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
AlphaFold Q8VI47
Predicted Effect probably benign
Transcript: ENSMUST00000026208
AA Change: S189P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: S189P

transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129943
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 G T 8: 95,040,315 V433F probably benign Het
Arhgap33 A T 7: 30,522,809 W1233R probably damaging Het
Brf2 T C 8: 27,128,549 D9G probably damaging Het
Btrc G A 19: 45,527,400 R562Q probably damaging Het
Cenpu T C 8: 46,556,190 F67L probably damaging Het
Chia1 T C 3: 106,128,474 M150T probably damaging Het
Cntln A G 4: 85,100,835 E1254G probably damaging Het
Creld1 G A 6: 113,492,205 C332Y probably damaging Het
Ctla2a A G 13: 60,935,541 probably benign Het
Dusp13 A T 14: 21,734,975 D223E probably benign Het
Ext1 C A 15: 53,075,792 L620F probably damaging Het
Gm6614 C A 6: 141,993,637 probably null Het
H2-DMb2 C T 17: 34,147,860 R89C probably damaging Het
Klhl32 A T 4: 24,743,916 L17* probably null Het
Lats2 C T 14: 57,697,354 V640M probably damaging Het
Lrig3 G A 10: 126,009,825 V708I possibly damaging Het
Mtcl1 T C 17: 66,379,320 T415A probably benign Het
Mynn A G 3: 30,616,813 *611W probably null Het
Nfx1 A G 4: 41,009,240 T793A possibly damaging Het
Nlrp4d T C 7: 10,382,677 noncoding transcript Het
Nos3 T C 5: 24,368,820 V194A probably damaging Het
Npc1l1 C T 11: 6,217,473 probably null Het
Nrg2 T C 18: 36,021,097 D589G probably damaging Het
Olfr1008 T A 2: 85,689,606 M59K probably damaging Het
Olfr126 T C 17: 37,850,948 S119P probably damaging Het
Olfr1390 A G 11: 49,340,712 Y60C probably damaging Het
Olfr1418 T C 19: 11,855,471 T161A probably damaging Het
Omg C T 11: 79,501,719 probably benign Het
P2ry2 G T 7: 100,998,851 Y82* probably null Het
Pcdh1 T C 18: 38,202,842 T247A possibly damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pgm3 A G 9: 86,565,690 Y167H possibly damaging Het
Pramef20 A T 4: 144,376,915 C214S probably benign Het
Prmt2 T C 10: 76,222,468 H169R probably benign Het
Rad51ap2 T A 12: 11,456,250 S58T possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Slc6a15 T C 10: 103,395,064 S217P probably benign Het
Snx27 G A 3: 94,519,109 T361I probably damaging Het
St7l A G 3: 104,868,047 T80A probably damaging Het
Stk32b T A 5: 37,531,687 M98L possibly damaging Het
Tonsl C A 15: 76,624,150 A6S possibly damaging Het
Tpx2 A G 2: 152,869,691 R49G probably benign Het
Trmt2a A G 16: 18,249,894 K144E possibly damaging Het
Trpm7 A C 2: 126,812,777 L1414V probably benign Het
Ugdh T C 5: 65,423,596 K107E possibly damaging Het
Vamp3 A T 4: 151,050,909 probably benign Het
Vmn1r172 T C 7: 23,660,226 S179P probably damaging Het
Vmn1r28 A G 6: 58,265,978 M269V probably benign Het
Vmn2r94 T C 17: 18,244,214 T605A probably benign Het
Vwce A G 19: 10,638,156 T134A possibly damaging Het
Zfp277 T C 12: 40,445,746 E5G probably benign Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
BB002:Abcc2 UTSW 19 43807112 missense probably benign 0.07
BB012:Abcc2 UTSW 19 43807112 missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 splice site probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 splice site probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7919:Abcc2 UTSW 19 43816809 missense probably damaging 1.00
R7925:Abcc2 UTSW 19 43807112 missense probably benign 0.07
R7993:Abcc2 UTSW 19 43814792 missense possibly damaging 0.71
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
R8177:Abcc2 UTSW 19 43807080 missense probably damaging 1.00
R8492:Abcc2 UTSW 19 43804971 missense probably benign 0.07
R8693:Abcc2 UTSW 19 43822035 missense probably benign 0.06
R8722:Abcc2 UTSW 19 43836613 missense possibly damaging 0.89
R8734:Abcc2 UTSW 19 43782416 missense probably damaging 1.00
R8774:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8774-TAIL:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8798:Abcc2 UTSW 19 43808666 missense probably benign 0.01
R8889:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8892:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8936:Abcc2 UTSW 19 43808662 missense probably benign 0.35
R9031:Abcc2 UTSW 19 43822027 missense probably benign
R9116:Abcc2 UTSW 19 43804952 missense probably benign 0.30
R9201:Abcc2 UTSW 19 43798441 missense probably damaging 0.97
R9246:Abcc2 UTSW 19 43798443 missense probably benign 0.01
R9345:Abcc2 UTSW 19 43819430 missense probably damaging 0.97
R9487:Abcc2 UTSW 19 43818032 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-06-30