Incidental Mutation 'R1883:Vps54'
ID209285
Institutional Source Beutler Lab
Gene Symbol Vps54
Ensembl Gene ENSMUSG00000020128
Gene NameVPS54 GARP complex subunit
Synonyms5330404P15Rik, wr, mSLP8, Vps54l
MMRRC Submission 039904-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R1883 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location21239281-21321136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21312967 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 685 (T685S)
Ref Sequence ENSEMBL: ENSMUSP00000116739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006221] [ENSMUST00000109578] [ENSMUST00000132017]
Predicted Effect probably benign
Transcript: ENSMUST00000006221
AA Change: T847S

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006221
Gene: ENSMUSG00000020128
AA Change: T847S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 198 364 2.1e-12 PFAM
Pfam:Vps54 736 868 3.3e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109578
AA Change: T835S

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105206
Gene: ENSMUSG00000020128
AA Change: T835S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 186 352 2.3e-12 PFAM
Pfam:Vps54 723 857 1.6e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132017
AA Change: T685S

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116739
Gene: ENSMUSG00000020128
AA Change: T685S

DomainStartEndE-ValueType
Pfam:DUF2450 72 238 1.4e-12 PFAM
Pfam:Vps54 573 707 7.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153411
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes for a protein that in yeast forms part of a trimeric vacuolar-protein-sorting complex that is required for retrograde transport of proteins from prevacuoles to the late Golgi compartment. As in yeast, mammalian Vps54 proteins contain a coiled-coil region and dileucine motifs. Alternative splicing results in multiple transcript variants encoding different isoforms [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show progressive ataxia, tremors, and limb paralysis with degeneration of motor nerve cells of brainstem and spinal cord and atrophy of skeletal muscle beginning about 3-weeks of age. Mutants are sterile and most die by 3-months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,453 T339A probably benign Het
Ano9 T C 7: 141,102,331 E677G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Capn9 A G 8: 124,611,558 K552R probably benign Het
Catsperg1 C T 7: 29,182,236 probably null Het
Cdc16 A G 8: 13,775,738 N449D probably damaging Het
Cdyl2 A T 8: 116,595,163 N208K probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Crybg2 C A 4: 134,074,283 S918* probably null Het
Dact2 A T 17: 14,197,823 S207T possibly damaging Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx18 C A 1: 121,567,916 probably benign Het
Dis3 A T 14: 99,091,469 H282Q probably benign Het
Dnah3 T C 7: 120,077,919 D453G probably benign Het
Dst T C 1: 34,189,308 V1994A possibly damaging Het
Dusp8 C T 7: 142,084,348 probably null Het
Eipr1 A T 12: 28,766,851 H69L possibly damaging Het
Eml1 A G 12: 108,463,652 R65G probably damaging Het
Epha7 C T 4: 28,950,362 H722Y possibly damaging Het
Epyc A T 10: 97,675,833 K229N possibly damaging Het
Extl1 A G 4: 134,364,606 I312T probably benign Het
F13a1 G C 13: 36,989,007 A133G probably benign Het
Fam185a G T 5: 21,425,244 C26F possibly damaging Het
Fam186b T C 15: 99,278,798 N737S probably damaging Het
Fam78b A G 1: 167,001,602 I13V probably benign Het
Fat1 A T 8: 45,051,147 Q4559L probably benign Het
Fnip1 T C 11: 54,515,547 S1157P probably damaging Het
Foxj3 A C 4: 119,610,029 M190L probably benign Het
Gm5096 T C 18: 87,756,545 L64P probably damaging Het
Heatr3 T C 8: 88,144,593 Y192H possibly damaging Het
Hexdc T A 11: 121,207,698 S3T probably benign Het
Klf3 C T 5: 64,822,881 P5S probably damaging Het
Klf9 C T 19: 23,164,737 S187L probably damaging Het
Krt9 T C 11: 100,188,697 H623R unknown Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lmtk3 T C 7: 45,786,849 Y84H probably damaging Het
Mroh3 G T 1: 136,206,993 A166D probably damaging Het
Musk C A 4: 58,373,189 P697T probably benign Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nipbl A C 15: 8,327,132 F1590C probably damaging Het
Nrk G T X: 139,007,173 V1455F probably damaging Het
Nsun3 T C 16: 62,735,293 D290G probably damaging Het
Obscn T C 11: 59,078,203 T222A probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Olfr6 T C 7: 106,956,774 H54R probably benign Het
Osbpl11 T G 16: 33,214,353 H237Q probably benign Het
Pde10a A T 17: 8,978,944 T671S possibly damaging Het
Pkd2 A T 5: 104,483,228 N506I probably damaging Het
Ppp3cb A G 14: 20,523,845 V274A possibly damaging Het
Prex1 T C 2: 166,583,272 D938G probably benign Het
Ptch1 G A 13: 63,512,027 Q1134* probably null Het
Rasgrf2 A G 13: 91,969,030 V820A probably benign Het
Rimbp2 C T 5: 128,803,934 V137M possibly damaging Het
Rpa1 A G 11: 75,318,483 V137A probably benign Het
Rps6ka1 A C 4: 133,864,043 I299S probably damaging Het
Scn3b A C 9: 40,279,373 probably null Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Snx14 T A 9: 88,402,261 E451D probably benign Het
Swt1 T A 1: 151,423,533 K8* probably null Het
Tas1r3 G T 4: 155,862,153 P332T probably damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tecpr1 A G 5: 144,206,529 V676A probably benign Het
Tg A G 15: 66,671,309 E24G probably damaging Het
Tlr7 C T X: 167,306,472 G673S probably benign Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Trabd A G 15: 89,081,981 E47G probably damaging Het
Trim29 T A 9: 43,311,405 I177N probably damaging Het
Ubxn2a A T 12: 4,894,563 L53* probably null Het
Ulk2 A G 11: 61,830,612 L208P probably damaging Het
Unc80 G A 1: 66,525,770 C872Y possibly damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vmn1r20 C A 6: 57,432,321 H211N probably benign Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vwa5b1 A G 4: 138,575,389 W932R probably damaging Het
Wdr53 A T 16: 32,256,498 I174F possibly damaging Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp60 T C 7: 27,750,010 L701P probably benign Het
Zfp609 A T 9: 65,794,758 M204K probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Zfp995 A T 17: 21,880,641 I204N probably benign Het
Zp2 C T 7: 120,133,401 D641N probably benign Het
Other mutations in Vps54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Vps54 APN 11 21277909 missense possibly damaging 0.74
IGL01070:Vps54 APN 11 21312268 missense probably damaging 1.00
IGL01398:Vps54 APN 11 21295403 splice site probably benign
IGL01450:Vps54 APN 11 21291135 missense probably benign 0.00
IGL01611:Vps54 APN 11 21311082 missense probably damaging 1.00
IGL01801:Vps54 APN 11 21275131 critical splice donor site probably null
IGL01872:Vps54 APN 11 21306940 missense probably damaging 0.99
IGL02071:Vps54 APN 11 21275071 missense probably null 0.00
IGL02186:Vps54 APN 11 21306947 missense probably damaging 1.00
IGL03358:Vps54 APN 11 21268799 missense probably damaging 1.00
R0031:Vps54 UTSW 11 21312899 missense probably damaging 1.00
R0147:Vps54 UTSW 11 21300259 missense probably benign 0.02
R0158:Vps54 UTSW 11 21306962 missense probably damaging 1.00
R0385:Vps54 UTSW 11 21306381 missense possibly damaging 0.94
R0420:Vps54 UTSW 11 21311071 splice site probably benign
R0582:Vps54 UTSW 11 21300137 missense probably damaging 1.00
R0602:Vps54 UTSW 11 21306434 missense possibly damaging 0.92
R1051:Vps54 UTSW 11 21278001 frame shift probably null
R1280:Vps54 UTSW 11 21277868 missense possibly damaging 0.88
R1720:Vps54 UTSW 11 21306519 missense probably damaging 1.00
R1875:Vps54 UTSW 11 21300251 missense probably benign 0.00
R1971:Vps54 UTSW 11 21292051 missense probably damaging 1.00
R2063:Vps54 UTSW 11 21277955 missense probably damaging 1.00
R2171:Vps54 UTSW 11 21298810 missense probably benign 0.16
R2518:Vps54 UTSW 11 21306394 missense probably benign 0.01
R3801:Vps54 UTSW 11 21268832 missense probably benign 0.00
R4049:Vps54 UTSW 11 21300183 missense probably benign 0.00
R4108:Vps54 UTSW 11 21312877 missense probably benign 0.02
R4560:Vps54 UTSW 11 21312260 missense possibly damaging 0.91
R4668:Vps54 UTSW 11 21299989 missense probably benign 0.04
R4772:Vps54 UTSW 11 21312952 missense probably damaging 1.00
R5061:Vps54 UTSW 11 21319881 utr 3 prime probably benign
R5611:Vps54 UTSW 11 21311130 missense possibly damaging 0.65
R5638:Vps54 UTSW 11 21308799 missense probably damaging 1.00
R5670:Vps54 UTSW 11 21264864 missense probably damaging 1.00
R7095:Vps54 UTSW 11 21271720 missense probably benign 0.12
R7175:Vps54 UTSW 11 21315028 critical splice donor site probably null
R7179:Vps54 UTSW 11 21298791 missense probably damaging 1.00
R7269:Vps54 UTSW 11 21277670 splice site probably null
R7286:Vps54 UTSW 11 21275005 missense probably benign 0.30
R7344:Vps54 UTSW 11 21274999 missense probably damaging 1.00
R7552:Vps54 UTSW 11 21298831 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTCCAGTGAGAAAGCAGTGTGC -3'
(R):5'- ATCCATTATCGCTACAAGCTTAGC -3'

Sequencing Primer
(F):5'- TGAAATATATTTTCTGCCATGGTGC -3'
(R):5'- CGCTACAAGCTTAGCTGAAATTTC -3'
Posted On2014-06-30