Incidental Mutation 'R1883:Nek9'
ID209295
Institutional Source Beutler Lab
Gene Symbol Nek9
Ensembl Gene ENSMUSG00000034290
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 9
SynonymsC130021H08Rik
MMRRC Submission 039904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1883 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85299514-85339362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85332556 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 192 (L192P)
Ref Sequence ENSEMBL: ENSMUSP00000049056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040992]
Predicted Effect probably damaging
Transcript: ENSMUST00000040992
AA Change: L192P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049056
Gene: ENSMUSG00000034290
AA Change: L192P

DomainStartEndE-ValueType
low complexity region 19 49 N/A INTRINSIC
S_TKc 52 308 1.07e-73 SMART
Pfam:RCC1 389 441 1.2e-9 PFAM
Pfam:RCC1_2 428 457 1.5e-8 PFAM
Pfam:RCC1 444 495 3.6e-13 PFAM
Pfam:RCC1_2 482 511 3.6e-11 PFAM
Pfam:RCC1 499 547 7.6e-14 PFAM
Pfam:RCC1 615 665 4.2e-8 PFAM
Pfam:RCC1_2 652 681 4.4e-7 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 910 927 N/A INTRINSIC
Meta Mutation Damage Score 0.9739 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein is activated in mitosis and, in turn, activates other family members during mitosis. This protein also mediates cellular processes that are essential for interphase progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,453 T339A probably benign Het
Ano9 T C 7: 141,102,331 E677G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Capn9 A G 8: 124,611,558 K552R probably benign Het
Catsperg1 C T 7: 29,182,236 probably null Het
Cdc16 A G 8: 13,775,738 N449D probably damaging Het
Cdyl2 A T 8: 116,595,163 N208K probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Crybg2 C A 4: 134,074,283 S918* probably null Het
Dact2 A T 17: 14,197,823 S207T possibly damaging Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx18 C A 1: 121,567,916 probably benign Het
Dis3 A T 14: 99,091,469 H282Q probably benign Het
Dnah3 T C 7: 120,077,919 D453G probably benign Het
Dst T C 1: 34,189,308 V1994A possibly damaging Het
Dusp8 C T 7: 142,084,348 probably null Het
Eipr1 A T 12: 28,766,851 H69L possibly damaging Het
Eml1 A G 12: 108,463,652 R65G probably damaging Het
Epha7 C T 4: 28,950,362 H722Y possibly damaging Het
Epyc A T 10: 97,675,833 K229N possibly damaging Het
Extl1 A G 4: 134,364,606 I312T probably benign Het
F13a1 G C 13: 36,989,007 A133G probably benign Het
Fam185a G T 5: 21,425,244 C26F possibly damaging Het
Fam186b T C 15: 99,278,798 N737S probably damaging Het
Fam78b A G 1: 167,001,602 I13V probably benign Het
Fat1 A T 8: 45,051,147 Q4559L probably benign Het
Fnip1 T C 11: 54,515,547 S1157P probably damaging Het
Foxj3 A C 4: 119,610,029 M190L probably benign Het
Gm5096 T C 18: 87,756,545 L64P probably damaging Het
Heatr3 T C 8: 88,144,593 Y192H possibly damaging Het
Hexdc T A 11: 121,207,698 S3T probably benign Het
Klf3 C T 5: 64,822,881 P5S probably damaging Het
Klf9 C T 19: 23,164,737 S187L probably damaging Het
Krt9 T C 11: 100,188,697 H623R unknown Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lmtk3 T C 7: 45,786,849 Y84H probably damaging Het
Mroh3 G T 1: 136,206,993 A166D probably damaging Het
Musk C A 4: 58,373,189 P697T probably benign Het
Nipbl A C 15: 8,327,132 F1590C probably damaging Het
Nrk G T X: 139,007,173 V1455F probably damaging Het
Nsun3 T C 16: 62,735,293 D290G probably damaging Het
Obscn T C 11: 59,078,203 T222A probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Olfr6 T C 7: 106,956,774 H54R probably benign Het
Osbpl11 T G 16: 33,214,353 H237Q probably benign Het
Pde10a A T 17: 8,978,944 T671S possibly damaging Het
Pkd2 A T 5: 104,483,228 N506I probably damaging Het
Ppp3cb A G 14: 20,523,845 V274A possibly damaging Het
Prex1 T C 2: 166,583,272 D938G probably benign Het
Ptch1 G A 13: 63,512,027 Q1134* probably null Het
Rasgrf2 A G 13: 91,969,030 V820A probably benign Het
Rimbp2 C T 5: 128,803,934 V137M possibly damaging Het
Rpa1 A G 11: 75,318,483 V137A probably benign Het
Rps6ka1 A C 4: 133,864,043 I299S probably damaging Het
Scn3b A C 9: 40,279,373 probably null Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Snx14 T A 9: 88,402,261 E451D probably benign Het
Swt1 T A 1: 151,423,533 K8* probably null Het
Tas1r3 G T 4: 155,862,153 P332T probably damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tecpr1 A G 5: 144,206,529 V676A probably benign Het
Tg A G 15: 66,671,309 E24G probably damaging Het
Tlr7 C T X: 167,306,472 G673S probably benign Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Trabd A G 15: 89,081,981 E47G probably damaging Het
Trim29 T A 9: 43,311,405 I177N probably damaging Het
Ubxn2a A T 12: 4,894,563 L53* probably null Het
Ulk2 A G 11: 61,830,612 L208P probably damaging Het
Unc80 G A 1: 66,525,770 C872Y possibly damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vmn1r20 C A 6: 57,432,321 H211N probably benign Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps54 A T 11: 21,312,967 T685S possibly damaging Het
Vwa5b1 A G 4: 138,575,389 W932R probably damaging Het
Wdr53 A T 16: 32,256,498 I174F possibly damaging Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp60 T C 7: 27,750,010 L701P probably benign Het
Zfp609 A T 9: 65,794,758 M204K probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Zfp995 A T 17: 21,880,641 I204N probably benign Het
Zp2 C T 7: 120,133,401 D641N probably benign Het
Other mutations in Nek9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Nek9 APN 12 85314587 missense probably benign 0.23
IGL01595:Nek9 APN 12 85314420 missense probably damaging 1.00
IGL01603:Nek9 APN 12 85305605 missense probably damaging 1.00
IGL01893:Nek9 APN 12 85336400 missense probably damaging 1.00
IGL02017:Nek9 APN 12 85329923 missense probably damaging 1.00
IGL02197:Nek9 APN 12 85307930 missense probably null
IGL02207:Nek9 APN 12 85303483 nonsense probably null
IGL02749:Nek9 APN 12 85305507 missense probably benign 0.02
IGL02756:Nek9 APN 12 85311336 critical splice donor site probably null
IGL03343:Nek9 APN 12 85303609 missense probably damaging 1.00
Rose_colored UTSW 12 85303537 missense probably damaging 1.00
R0048:Nek9 UTSW 12 85301899 missense probably benign 0.17
R0331:Nek9 UTSW 12 85327375 splice site probably benign
R0499:Nek9 UTSW 12 85301883 missense probably benign 0.09
R1484:Nek9 UTSW 12 85301848 missense probably damaging 1.00
R1760:Nek9 UTSW 12 85305590 missense possibly damaging 0.71
R1760:Nek9 UTSW 12 85310410 missense probably benign 0.00
R1884:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1999:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2046:Nek9 UTSW 12 85320707 splice site probably benign
R2096:Nek9 UTSW 12 85314548 missense probably benign 0.00
R2150:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2368:Nek9 UTSW 12 85329887 missense possibly damaging 0.89
R2570:Nek9 UTSW 12 85332546 nonsense probably null
R4381:Nek9 UTSW 12 85329858 missense probably damaging 1.00
R4570:Nek9 UTSW 12 85320734 missense probably damaging 1.00
R4661:Nek9 UTSW 12 85320892 missense possibly damaging 0.78
R4669:Nek9 UTSW 12 85314204 missense probably benign 0.00
R4993:Nek9 UTSW 12 85310420 missense probably damaging 1.00
R5071:Nek9 UTSW 12 85327459 missense possibly damaging 0.70
R5090:Nek9 UTSW 12 85329842 critical splice donor site probably null
R5248:Nek9 UTSW 12 85308977 missense probably damaging 1.00
R5521:Nek9 UTSW 12 85327445 missense probably benign 0.09
R5734:Nek9 UTSW 12 85303515 missense probably benign
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6269:Nek9 UTSW 12 85332329 intron probably null
R6353:Nek9 UTSW 12 85301829 missense probably damaging 0.96
R6406:Nek9 UTSW 12 85339172 missense probably damaging 0.97
R6744:Nek9 UTSW 12 85329929 missense probably benign 0.09
R6922:Nek9 UTSW 12 85303537 missense probably damaging 1.00
R7603:Nek9 UTSW 12 85303514 missense probably benign 0.00
R7686:Nek9 UTSW 12 85303659 missense probably benign 0.01
X0052:Nek9 UTSW 12 85322027 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATCATGTGAGCCCATAC -3'
(R):5'- AACCCTGTGAGCGAAACCAG -3'

Sequencing Primer
(F):5'- TTATAGCTCTTGCAGAGGACCCAG -3'
(R):5'- GAAACCAGGAGATGCTAACACTC -3'
Posted On2014-06-30