Incidental Mutation 'R1883:Nipbl'
ID209305
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene NameNIPBL cohesin loading factor
Synonyms4921518A06Rik, 4933421G18Rik
MMRRC Submission 039904-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1883 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location8290617-8444463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 8327132 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 1590 (F1590C)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
Predicted Effect probably damaging
Transcript: ENSMUST00000052965
AA Change: F1590C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: F1590C

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,453 T339A probably benign Het
Ano9 T C 7: 141,102,331 E677G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Capn9 A G 8: 124,611,558 K552R probably benign Het
Catsperg1 C T 7: 29,182,236 probably null Het
Cdc16 A G 8: 13,775,738 N449D probably damaging Het
Cdyl2 A T 8: 116,595,163 N208K probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Crybg2 C A 4: 134,074,283 S918* probably null Het
Dact2 A T 17: 14,197,823 S207T possibly damaging Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx18 C A 1: 121,567,916 probably benign Het
Dis3 A T 14: 99,091,469 H282Q probably benign Het
Dnah3 T C 7: 120,077,919 D453G probably benign Het
Dst T C 1: 34,189,308 V1994A possibly damaging Het
Dusp8 C T 7: 142,084,348 probably null Het
Eipr1 A T 12: 28,766,851 H69L possibly damaging Het
Eml1 A G 12: 108,463,652 R65G probably damaging Het
Epha7 C T 4: 28,950,362 H722Y possibly damaging Het
Epyc A T 10: 97,675,833 K229N possibly damaging Het
Extl1 A G 4: 134,364,606 I312T probably benign Het
F13a1 G C 13: 36,989,007 A133G probably benign Het
Fam185a G T 5: 21,425,244 C26F possibly damaging Het
Fam186b T C 15: 99,278,798 N737S probably damaging Het
Fam78b A G 1: 167,001,602 I13V probably benign Het
Fat1 A T 8: 45,051,147 Q4559L probably benign Het
Fnip1 T C 11: 54,515,547 S1157P probably damaging Het
Foxj3 A C 4: 119,610,029 M190L probably benign Het
Gm5096 T C 18: 87,756,545 L64P probably damaging Het
Heatr3 T C 8: 88,144,593 Y192H possibly damaging Het
Hexdc T A 11: 121,207,698 S3T probably benign Het
Klf3 C T 5: 64,822,881 P5S probably damaging Het
Klf9 C T 19: 23,164,737 S187L probably damaging Het
Krt9 T C 11: 100,188,697 H623R unknown Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lmtk3 T C 7: 45,786,849 Y84H probably damaging Het
Mroh3 G T 1: 136,206,993 A166D probably damaging Het
Musk C A 4: 58,373,189 P697T probably benign Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nrk G T X: 139,007,173 V1455F probably damaging Het
Nsun3 T C 16: 62,735,293 D290G probably damaging Het
Obscn T C 11: 59,078,203 T222A probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Olfr6 T C 7: 106,956,774 H54R probably benign Het
Osbpl11 T G 16: 33,214,353 H237Q probably benign Het
Pde10a A T 17: 8,978,944 T671S possibly damaging Het
Pkd2 A T 5: 104,483,228 N506I probably damaging Het
Ppp3cb A G 14: 20,523,845 V274A possibly damaging Het
Prex1 T C 2: 166,583,272 D938G probably benign Het
Ptch1 G A 13: 63,512,027 Q1134* probably null Het
Rasgrf2 A G 13: 91,969,030 V820A probably benign Het
Rimbp2 C T 5: 128,803,934 V137M possibly damaging Het
Rpa1 A G 11: 75,318,483 V137A probably benign Het
Rps6ka1 A C 4: 133,864,043 I299S probably damaging Het
Scn3b A C 9: 40,279,373 probably null Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Snx14 T A 9: 88,402,261 E451D probably benign Het
Swt1 T A 1: 151,423,533 K8* probably null Het
Tas1r3 G T 4: 155,862,153 P332T probably damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tecpr1 A G 5: 144,206,529 V676A probably benign Het
Tg A G 15: 66,671,309 E24G probably damaging Het
Tlr7 C T X: 167,306,472 G673S probably benign Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Trabd A G 15: 89,081,981 E47G probably damaging Het
Trim29 T A 9: 43,311,405 I177N probably damaging Het
Ubxn2a A T 12: 4,894,563 L53* probably null Het
Ulk2 A G 11: 61,830,612 L208P probably damaging Het
Unc80 G A 1: 66,525,770 C872Y possibly damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vmn1r20 C A 6: 57,432,321 H211N probably benign Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps54 A T 11: 21,312,967 T685S possibly damaging Het
Vwa5b1 A G 4: 138,575,389 W932R probably damaging Het
Wdr53 A T 16: 32,256,498 I174F possibly damaging Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp60 T C 7: 27,750,010 L701P probably benign Het
Zfp609 A T 9: 65,794,758 M204K probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Zfp995 A T 17: 21,880,641 I204N probably benign Het
Zp2 C T 7: 120,133,401 D641N probably benign Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8360956 missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8350732 missense probably benign
R6388_Nipbl_651 UTSW 15 8300784 missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8293115 missense probably benign 0.00
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8360956 missense probably damaging 0.99
R0347:Nipbl UTSW 15 8350732 missense probably benign
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0667:Nipbl UTSW 15 8361004 missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2163:Nipbl UTSW 15 8336919 missense probably damaging 0.99
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
R7346:Nipbl UTSW 15 8343606 missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8330295 missense probably benign 0.01
R7486:Nipbl UTSW 15 8295636 missense probably benign 0.25
R7598:Nipbl UTSW 15 8343493 missense probably benign 0.24
R7609:Nipbl UTSW 15 8305872 missense probably benign 0.27
R7674:Nipbl UTSW 15 8293101 missense probably benign 0.15
R7706:Nipbl UTSW 15 8351526 missense probably benign 0.01
R7760:Nipbl UTSW 15 8358702 missense probably damaging 1.00
R7766:Nipbl UTSW 15 8296849 missense probably benign 0.45
R7825:Nipbl UTSW 15 8291487 missense probably damaging 1.00
R7862:Nipbl UTSW 15 8325752 missense probably benign 0.06
R7958:Nipbl UTSW 15 8311258 missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8311250 missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8359212 missense probably benign 0.22
R8355:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8441:Nipbl UTSW 15 8293115 missense probably benign 0.00
R8455:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8717:Nipbl UTSW 15 8338741 missense probably benign
R8739:Nipbl UTSW 15 8303420 missense probably benign 0.08
RF020:Nipbl UTSW 15 8358934 missense probably damaging 0.98
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8338699 missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8336952 missense probably damaging 1.00
Z1177:Nipbl UTSW 15 8338680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGACTAAATTAGACCCCGTCTC -3'
(R):5'- CATGGCACTTTTAAGTTCTCATAGTGC -3'

Sequencing Primer
(F):5'- TCTTTTTCCCACACCAAATGCAAAC -3'
(R):5'- CATAGTGCAATATAAGTAATGGAAAG -3'
Posted On2014-06-30