Incidental Mutation 'R1883:Pde10a'
ID209312
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission 039904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1883 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8978944 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 671 (T671S)
Ref Sequence ENSEMBL: ENSMUSP00000123216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect probably benign
Transcript: ENSMUST00000024647
AA Change: T660S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: T660S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
AA Change: T740S

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: T740S

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115708
AA Change: T456S

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: T456S

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115715
AA Change: T660S

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: T660S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: T723S

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: T723S

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115724
AA Change: T794S

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: T794S

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149440
AA Change: T671S

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: T671S

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231430
AA Change: T1022S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,453 T339A probably benign Het
Ano9 T C 7: 141,102,331 E677G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Capn9 A G 8: 124,611,558 K552R probably benign Het
Catsperg1 C T 7: 29,182,236 probably null Het
Cdc16 A G 8: 13,775,738 N449D probably damaging Het
Cdyl2 A T 8: 116,595,163 N208K probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Crybg2 C A 4: 134,074,283 S918* probably null Het
Dact2 A T 17: 14,197,823 S207T possibly damaging Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx18 C A 1: 121,567,916 probably benign Het
Dis3 A T 14: 99,091,469 H282Q probably benign Het
Dnah3 T C 7: 120,077,919 D453G probably benign Het
Dst T C 1: 34,189,308 V1994A possibly damaging Het
Dusp8 C T 7: 142,084,348 probably null Het
Eipr1 A T 12: 28,766,851 H69L possibly damaging Het
Eml1 A G 12: 108,463,652 R65G probably damaging Het
Epha7 C T 4: 28,950,362 H722Y possibly damaging Het
Epyc A T 10: 97,675,833 K229N possibly damaging Het
Extl1 A G 4: 134,364,606 I312T probably benign Het
F13a1 G C 13: 36,989,007 A133G probably benign Het
Fam185a G T 5: 21,425,244 C26F possibly damaging Het
Fam186b T C 15: 99,278,798 N737S probably damaging Het
Fam78b A G 1: 167,001,602 I13V probably benign Het
Fat1 A T 8: 45,051,147 Q4559L probably benign Het
Fnip1 T C 11: 54,515,547 S1157P probably damaging Het
Foxj3 A C 4: 119,610,029 M190L probably benign Het
Gm5096 T C 18: 87,756,545 L64P probably damaging Het
Heatr3 T C 8: 88,144,593 Y192H possibly damaging Het
Hexdc T A 11: 121,207,698 S3T probably benign Het
Klf3 C T 5: 64,822,881 P5S probably damaging Het
Klf9 C T 19: 23,164,737 S187L probably damaging Het
Krt9 T C 11: 100,188,697 H623R unknown Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lmtk3 T C 7: 45,786,849 Y84H probably damaging Het
Mroh3 G T 1: 136,206,993 A166D probably damaging Het
Musk C A 4: 58,373,189 P697T probably benign Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nipbl A C 15: 8,327,132 F1590C probably damaging Het
Nrk G T X: 139,007,173 V1455F probably damaging Het
Nsun3 T C 16: 62,735,293 D290G probably damaging Het
Obscn T C 11: 59,078,203 T222A probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Olfr6 T C 7: 106,956,774 H54R probably benign Het
Osbpl11 T G 16: 33,214,353 H237Q probably benign Het
Pkd2 A T 5: 104,483,228 N506I probably damaging Het
Ppp3cb A G 14: 20,523,845 V274A possibly damaging Het
Prex1 T C 2: 166,583,272 D938G probably benign Het
Ptch1 G A 13: 63,512,027 Q1134* probably null Het
Rasgrf2 A G 13: 91,969,030 V820A probably benign Het
Rimbp2 C T 5: 128,803,934 V137M possibly damaging Het
Rpa1 A G 11: 75,318,483 V137A probably benign Het
Rps6ka1 A C 4: 133,864,043 I299S probably damaging Het
Scn3b A C 9: 40,279,373 probably null Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Snx14 T A 9: 88,402,261 E451D probably benign Het
Swt1 T A 1: 151,423,533 K8* probably null Het
Tas1r3 G T 4: 155,862,153 P332T probably damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tecpr1 A G 5: 144,206,529 V676A probably benign Het
Tg A G 15: 66,671,309 E24G probably damaging Het
Tlr7 C T X: 167,306,472 G673S probably benign Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Trabd A G 15: 89,081,981 E47G probably damaging Het
Trim29 T A 9: 43,311,405 I177N probably damaging Het
Ubxn2a A T 12: 4,894,563 L53* probably null Het
Ulk2 A G 11: 61,830,612 L208P probably damaging Het
Unc80 G A 1: 66,525,770 C872Y possibly damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vmn1r20 C A 6: 57,432,321 H211N probably benign Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps54 A T 11: 21,312,967 T685S possibly damaging Het
Vwa5b1 A G 4: 138,575,389 W932R probably damaging Het
Wdr53 A T 16: 32,256,498 I174F possibly damaging Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp60 T C 7: 27,750,010 L701P probably benign Het
Zfp609 A T 9: 65,794,758 M204K probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Zfp995 A T 17: 21,880,641 I204N probably benign Het
Zp2 C T 7: 120,133,401 D641N probably benign Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
buzzed UTSW 17 8930537 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CCATGCAGAGGATACAGCAC -3'
(R):5'- TGGCTTTGGGAGAGGACTAC -3'

Sequencing Primer
(F):5'- TGCAGAGGATACAGCACACATACAG -3'
(R):5'- TATCAGAGCAGAAGCATGGGTTTC -3'
Posted On2014-06-30