Incidental Mutation 'R1884:Dnah7a'
ID209322
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53541000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1592 (I1592N)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect probably damaging
Transcript: ENSMUST00000094964
AA Change: I1592N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: I1592N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Meta Mutation Damage Score 0.5176 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53531203 missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense probably benign 0.00
R7096:Dnah7a UTSW 1 53483440 missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
R7144:Dnah7a UTSW 1 53698708 splice site probably null
R7167:Dnah7a UTSW 1 53503776 missense probably benign 0.00
R7182:Dnah7a UTSW 1 53620461 intron probably null
R7196:Dnah7a UTSW 1 53684841 missense probably benign 0.00
R7206:Dnah7a UTSW 1 53698633 nonsense probably null
R7215:Dnah7a UTSW 1 53618350 missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53397261 missense probably benign 0.00
R7264:Dnah7a UTSW 1 53518814 missense probably benign
R7282:Dnah7a UTSW 1 53684900 critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53497138 missense probably benign
R7392:Dnah7a UTSW 1 53501661 missense probably benign 0.00
R7454:Dnah7a UTSW 1 53518764 missense probably benign
R7471:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53663837 missense probably benign 0.00
R7554:Dnah7a UTSW 1 53528698 missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53547297 missense probably benign 0.00
R7721:Dnah7a UTSW 1 53631683 missense probably benign
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACCACCCTGTATCCTTTCTGAC -3'
(R):5'- TAGTTTGCCAGACTTCAGGG -3'

Sequencing Primer
(F):5'- TCTGACACAGATAAATATCAACAAGC -3'
(R):5'- TTGCCAGACTTCAGGGTATAAG -3'
Posted On2014-06-30