Incidental Mutation 'R1884:Olfr583'
ID209351
Institutional Source Beutler Lab
Gene Symbol Olfr583
Ensembl Gene ENSMUSG00000073960
Gene Nameolfactory receptor 583
SynonymsMOR14-6, GA_x6K02T2PBJ9-5762668-5763618
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103051300-103052259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103051982 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 228 (I228T)
Ref Sequence ENSEMBL: ENSMUSP00000095812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098211]
Predicted Effect probably benign
Transcript: ENSMUST00000098211
AA Change: I228T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095812
Gene: ENSMUSG00000073960
AA Change: I228T

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 9.1e-107 PFAM
Pfam:7TM_GPCR_Srsx 45 316 1.4e-5 PFAM
Pfam:7tm_1 50 301 9.6e-20 PFAM
Meta Mutation Damage Score 0.1793 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Olfr583
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Olfr583 APN 7 103051375 missense probably benign 0.02
IGL02200:Olfr583 APN 7 103051793 missense probably benign
IGL02412:Olfr583 APN 7 103052152 missense probably benign 0.01
IGL02452:Olfr583 APN 7 103051931 missense probably benign 0.00
IGL02859:Olfr583 APN 7 103052138 missense probably benign 0.00
IGL03078:Olfr583 APN 7 103051829 missense probably damaging 1.00
R0675:Olfr583 UTSW 7 103051702 missense probably benign 0.22
R1474:Olfr583 UTSW 7 103052081 missense probably damaging 1.00
R1531:Olfr583 UTSW 7 103051588 missense probably benign 0.00
R1535:Olfr583 UTSW 7 103051369 missense probably benign 0.14
R1777:Olfr583 UTSW 7 103051376 missense probably benign 0.41
R1883:Olfr583 UTSW 7 103051982 missense probably benign 0.00
R2265:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2267:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2269:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2299:Olfr583 UTSW 7 103051582 missense probably damaging 0.99
R3802:Olfr583 UTSW 7 103052165 missense probably benign 0.05
R4239:Olfr583 UTSW 7 103051796 missense probably benign 0.17
R4426:Olfr583 UTSW 7 103051811 missense probably damaging 1.00
R5335:Olfr583 UTSW 7 103051535 missense probably damaging 1.00
R6048:Olfr583 UTSW 7 103051319 missense probably benign 0.00
R6270:Olfr583 UTSW 7 103051331 missense probably benign 0.27
R6837:Olfr583 UTSW 7 103051722 nonsense probably null
R7257:Olfr583 UTSW 7 103051630 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGTTTCCTAGTGATAATGCACAC -3'
(R):5'- TGGCCATCATTGTATGGACTACC -3'

Sequencing Primer
(F):5'- TCCTAGTGATAATGCACACTCTAC -3'
(R):5'- TATGGACTACCTTGGGCACTGAC -3'
Posted On2014-06-30