Incidental Mutation 'R1885:Adcy10'
ID209407
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Nameadenylate cyclase 10
SynonymssAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 039906-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R1885 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165485183-165576774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165570808 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1491 (I1491M)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: I1491M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: I1491M

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: I1491M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: I1491M

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: I1491M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: I1491M

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158666
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Coding Region Coverage
  • 1x: 97.0%
  • 3x: 96.1%
  • 10x: 92.7%
  • 20x: 85.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acox2 C T 14: 8,248,102 M393I probably benign Het
Adcy3 T A 12: 4,134,951 V209E probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Apobec3 A T 15: 79,897,705 H82L probably damaging Het
Atg9b A T 5: 24,388,254 W384R probably damaging Het
Atp8a1 A G 5: 67,747,318 V506A possibly damaging Het
Atxn1 G T 13: 45,567,804 A205D probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B4galnt3 T C 6: 120,223,640 E223G probably damaging Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
C530008M17Rik A G 5: 76,856,742 T317A unknown Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Caprin2 A T 6: 148,877,885 probably null Het
Ccdc80 A C 16: 45,096,720 D613A probably benign Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cebpz A T 17: 78,932,116 D625E probably benign Het
Coq6 C A 12: 84,372,464 N388K probably damaging Het
D430041D05Rik T C 2: 104,230,455 M1365V probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dpysl4 T G 7: 139,096,807 V391G probably damaging Het
Dyrk4 G T 6: 126,877,181 Q550K probably benign Het
Epas1 A G 17: 86,805,295 D107G probably damaging Het
Esrp2 A G 8: 106,131,821 V636A possibly damaging Het
Etl4 T A 2: 20,743,984 Y176N probably damaging Het
Etnppl T C 3: 130,629,462 V264A probably benign Het
Fer T A 17: 64,138,914 V790D probably damaging Het
Gdpd5 G A 7: 99,459,997 V575I probably benign Het
Gif G A 19: 11,752,324 A216T probably benign Het
Gipc3 T C 10: 81,341,347 I130V probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Iqsec3 G A 6: 121,428,367 probably benign Het
Kdm5d G T Y: 940,781 probably null Het
Kl A G 5: 150,953,494 R260G possibly damaging Het
Kras T C 6: 145,232,117 E143G probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Ksr1 T C 11: 79,036,521 T329A probably damaging Het
March6 A G 15: 31,502,806 V83A probably benign Het
Mettl2 T C 11: 105,131,620 I212T possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mlh1 C A 9: 111,258,556 S24I probably benign Het
Mmel1 G A 4: 154,890,876 R424Q possibly damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Myh3 A G 11: 67,086,627 K368E probably benign Het
Myo16 T A 8: 10,322,656 N118K probably damaging Het
Myo5c A G 9: 75,249,761 S160G probably damaging Het
Nat1 A T 8: 67,491,001 I13F probably damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nwd1 T C 8: 72,704,994 S1207P probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1390 T C 11: 49,340,835 L101P probably damaging Het
Olfr153 T C 2: 87,532,824 S264P probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Paqr8 A T 1: 20,935,480 H286L probably damaging Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pes1 A G 11: 3,969,482 K52E probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Robo2 T C 16: 73,916,145 D1283G probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Slc2a4 C T 11: 69,945,007 V339I probably benign Het
Slc39a6 G A 18: 24,601,482 probably null Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Snx33 T C 9: 56,925,837 H316R probably benign Het
Spata31d1a T G 13: 59,702,007 D769A probably damaging Het
Stmn2 A T 3: 8,541,904 E28V probably damaging Het
Syt9 A G 7: 107,436,529 D251G probably damaging Het
Tjap1 T C 17: 46,262,421 T37A probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tprg A G 16: 25,412,891 T206A probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc37 A T 13: 76,113,047 R112S probably benign Het
Ttc37 A G 13: 76,130,235 Q556R probably benign Het
Ubqlnl A T 7: 104,150,065 M75K possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r12 C T 5: 109,092,076 G207E probably damaging Het
Xrn2 T G 2: 147,049,361 L697* probably null Het
Zfp764 A G 7: 127,405,039 F307L probably benign Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Zranb2 A T 3: 157,543,156 probably null Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7182:Adcy10 UTSW 1 165543470 intron probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7561:Adcy10 UTSW 1 165559172 missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R7988:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165546549 missense possibly damaging 0.82
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCCAGACTTCAAGAGTGGG -3'
(R):5'- GCAGTGGTATCACCCAGTATG -3'

Sequencing Primer
(F):5'- GACTTCAAGAGTGGGACAACTTTAAC -3'
(R):5'- GTAGGTCTCATGGATCAAACACTGC -3'
Posted On2014-06-30