Incidental Mutation 'R1885:Gdpd5'
ID209440
Institutional Source Beutler Lab
Gene Symbol Gdpd5
Ensembl Gene ENSMUSG00000035314
Gene Nameglycerophosphodiester phosphodiesterase domain containing 5
SynonymsGde2
MMRRC Submission 039906-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1885 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location99381414-99461877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99459997 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 575 (V575I)
Ref Sequence ENSEMBL: ENSMUSP00000150361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037528] [ENSMUST00000213887]
Predicted Effect probably benign
Transcript: ENSMUST00000037528
AA Change: V570I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000036175
Gene: ENSMUSG00000035314
AA Change: V570I

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 127 146 N/A INTRINSIC
transmembrane domain 161 180 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Pfam:GDPD 233 380 9.8e-17 PFAM
transmembrane domain 498 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213887
AA Change: V575I

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 97.0%
  • 3x: 96.1%
  • 10x: 92.7%
  • 20x: 85.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycerophosphodiester phosphodiesterases (GDPDs; EC 3.1.4.46), such as GDPD5, are involved in glycerol metabolism (Lang et al., 2008 [PubMed 17578682]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired motor neuron differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acox2 C T 14: 8,248,102 M393I probably benign Het
Adcy10 A G 1: 165,570,808 I1491M probably benign Het
Adcy3 T A 12: 4,134,951 V209E probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Apobec3 A T 15: 79,897,705 H82L probably damaging Het
Atg9b A T 5: 24,388,254 W384R probably damaging Het
Atp8a1 A G 5: 67,747,318 V506A possibly damaging Het
Atxn1 G T 13: 45,567,804 A205D probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B4galnt3 T C 6: 120,223,640 E223G probably damaging Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
C530008M17Rik A G 5: 76,856,742 T317A unknown Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Caprin2 A T 6: 148,877,885 probably null Het
Ccdc80 A C 16: 45,096,720 D613A probably benign Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cebpz A T 17: 78,932,116 D625E probably benign Het
Coq6 C A 12: 84,372,464 N388K probably damaging Het
D430041D05Rik T C 2: 104,230,455 M1365V probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dpysl4 T G 7: 139,096,807 V391G probably damaging Het
Dyrk4 G T 6: 126,877,181 Q550K probably benign Het
Epas1 A G 17: 86,805,295 D107G probably damaging Het
Esrp2 A G 8: 106,131,821 V636A possibly damaging Het
Etl4 T A 2: 20,743,984 Y176N probably damaging Het
Etnppl T C 3: 130,629,462 V264A probably benign Het
Fer T A 17: 64,138,914 V790D probably damaging Het
Gif G A 19: 11,752,324 A216T probably benign Het
Gipc3 T C 10: 81,341,347 I130V probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Iqsec3 G A 6: 121,428,367 probably benign Het
Kdm5d G T Y: 940,781 probably null Het
Kl A G 5: 150,953,494 R260G possibly damaging Het
Kras T C 6: 145,232,117 E143G probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Ksr1 T C 11: 79,036,521 T329A probably damaging Het
March6 A G 15: 31,502,806 V83A probably benign Het
Mettl2 T C 11: 105,131,620 I212T possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mlh1 C A 9: 111,258,556 S24I probably benign Het
Mmel1 G A 4: 154,890,876 R424Q possibly damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Myh3 A G 11: 67,086,627 K368E probably benign Het
Myo16 T A 8: 10,322,656 N118K probably damaging Het
Myo5c A G 9: 75,249,761 S160G probably damaging Het
Nat1 A T 8: 67,491,001 I13F probably damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nwd1 T C 8: 72,704,994 S1207P probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1390 T C 11: 49,340,835 L101P probably damaging Het
Olfr153 T C 2: 87,532,824 S264P probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Paqr8 A T 1: 20,935,480 H286L probably damaging Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pes1 A G 11: 3,969,482 K52E probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Robo2 T C 16: 73,916,145 D1283G probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Slc2a4 C T 11: 69,945,007 V339I probably benign Het
Slc39a6 G A 18: 24,601,482 probably null Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Snx33 T C 9: 56,925,837 H316R probably benign Het
Spata31d1a T G 13: 59,702,007 D769A probably damaging Het
Stmn2 A T 3: 8,541,904 E28V probably damaging Het
Syt9 A G 7: 107,436,529 D251G probably damaging Het
Tjap1 T C 17: 46,262,421 T37A probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tprg A G 16: 25,412,891 T206A probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc37 A T 13: 76,113,047 R112S probably benign Het
Ttc37 A G 13: 76,130,235 Q556R probably benign Het
Ubqlnl A T 7: 104,150,065 M75K possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r12 C T 5: 109,092,076 G207E probably damaging Het
Xrn2 T G 2: 147,049,361 L697* probably null Het
Zfp764 A G 7: 127,405,039 F307L probably benign Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Zranb2 A T 3: 157,543,156 probably null Het
Other mutations in Gdpd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03291:Gdpd5 APN 7 99460121 utr 3 prime probably benign
R0149:Gdpd5 UTSW 7 99458790 missense possibly damaging 0.49
R0361:Gdpd5 UTSW 7 99458790 missense possibly damaging 0.49
R0811:Gdpd5 UTSW 7 99438333 missense probably damaging 1.00
R0812:Gdpd5 UTSW 7 99438333 missense probably damaging 1.00
R1633:Gdpd5 UTSW 7 99448513 missense probably benign
R1864:Gdpd5 UTSW 7 99448999 missense probably benign 0.04
R2099:Gdpd5 UTSW 7 99448489 missense probably damaging 1.00
R3776:Gdpd5 UTSW 7 99454572 missense probably benign 0.04
R3913:Gdpd5 UTSW 7 99438339 missense probably null 0.23
R5198:Gdpd5 UTSW 7 99438308 missense probably damaging 1.00
R5318:Gdpd5 UTSW 7 99453027 missense probably benign 0.03
R7356:Gdpd5 UTSW 7 99458878 missense probably damaging 1.00
R7654:Gdpd5 UTSW 7 99424189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTTCTGCAACAGGAGTTCC -3'
(R):5'- GTGCAGCTTCTTTTCATCAGAC -3'

Sequencing Primer
(F):5'- TGAACGCCAGGCTCAGTG -3'
(R):5'- ATCAGACCTTCCTCTCTTCTAGG -3'
Posted On2014-06-30