Incidental Mutation 'R1885:Tsta3'
ID209486
Institutional Source Beutler Lab
Gene Symbol Tsta3
Ensembl Gene ENSMUSG00000022570
Gene Nametissue specific transplantation antigen P35B
SynonymsTstap35b, FX, GDP-fucose synthase
MMRRC Submission 039906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1885 (G1)
Quality Score181
Status Not validated
Chromosome15
Chromosomal Location75924676-75929832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75926989 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 123 (T123N)
Ref Sequence ENSEMBL: ENSMUSP00000155711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023231] [ENSMUST00000229085] [ENSMUST00000229289] [ENSMUST00000229641] [ENSMUST00000229951] [ENSMUST00000230303] [ENSMUST00000230364] [ENSMUST00000230610] [ENSMUST00000230736]
Predicted Effect probably benign
Transcript: ENSMUST00000023231
AA Change: T123N

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023231
Gene: ENSMUSG00000022570
AA Change: T123N

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 8 74 1.2e-9 PFAM
Pfam:Epimerase 10 245 1.7e-59 PFAM
Pfam:GDP_Man_Dehyd 37 311 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229085
Predicted Effect probably benign
Transcript: ENSMUST00000229289
AA Change: T94N

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000229641
AA Change: T123N

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229786
Predicted Effect possibly damaging
Transcript: ENSMUST00000229951
AA Change: T123N

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229997
Predicted Effect probably benign
Transcript: ENSMUST00000230303
Predicted Effect probably benign
Transcript: ENSMUST00000230364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230485
Predicted Effect probably benign
Transcript: ENSMUST00000230610
Predicted Effect possibly damaging
Transcript: ENSMUST00000230736
AA Change: T123N

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230884
Coding Region Coverage
  • 1x: 97.0%
  • 3x: 96.1%
  • 10x: 92.7%
  • 20x: 85.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tissue specific transplantation antigen P35B is a NADP(H)-binding protein. It catalyze the two-step epimerase and the reductase reactions in GDP-D-mannose metabolism, converting GDP-4-keto-6-D-deoxymannose to GDP-L-fucose. GDP-L-fucose is the substrate of several fucosyltransferases involved in the expression of many glycoconjugates, including blood group ABH antigens and developmental adhesion antigens. Mutations in this gene may cause leukocyte adhesion deficiency, type II. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation frequently die in utero, while survivors are smaller than normal, show colon abnormalities, have reduced fertility, and frequently die before weaning. Heterozygotes also show some embryonic loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acox2 C T 14: 8,248,102 M393I probably benign Het
Adcy10 A G 1: 165,570,808 I1491M probably benign Het
Adcy3 T A 12: 4,134,951 V209E probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Apobec3 A T 15: 79,897,705 H82L probably damaging Het
Atg9b A T 5: 24,388,254 W384R probably damaging Het
Atp8a1 A G 5: 67,747,318 V506A possibly damaging Het
Atxn1 G T 13: 45,567,804 A205D probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B4galnt3 T C 6: 120,223,640 E223G probably damaging Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
C530008M17Rik A G 5: 76,856,742 T317A unknown Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Caprin2 A T 6: 148,877,885 probably null Het
Ccdc80 A C 16: 45,096,720 D613A probably benign Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cebpz A T 17: 78,932,116 D625E probably benign Het
Coq6 C A 12: 84,372,464 N388K probably damaging Het
D430041D05Rik T C 2: 104,230,455 M1365V probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dpysl4 T G 7: 139,096,807 V391G probably damaging Het
Dyrk4 G T 6: 126,877,181 Q550K probably benign Het
Epas1 A G 17: 86,805,295 D107G probably damaging Het
Esrp2 A G 8: 106,131,821 V636A possibly damaging Het
Etl4 T A 2: 20,743,984 Y176N probably damaging Het
Etnppl T C 3: 130,629,462 V264A probably benign Het
Fer T A 17: 64,138,914 V790D probably damaging Het
Gdpd5 G A 7: 99,459,997 V575I probably benign Het
Gif G A 19: 11,752,324 A216T probably benign Het
Gipc3 T C 10: 81,341,347 I130V probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Iqsec3 G A 6: 121,428,367 probably benign Het
Kdm5d G T Y: 940,781 probably null Het
Kl A G 5: 150,953,494 R260G possibly damaging Het
Kras T C 6: 145,232,117 E143G probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Ksr1 T C 11: 79,036,521 T329A probably damaging Het
March6 A G 15: 31,502,806 V83A probably benign Het
Mettl2 T C 11: 105,131,620 I212T possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mlh1 C A 9: 111,258,556 S24I probably benign Het
Mmel1 G A 4: 154,890,876 R424Q possibly damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Myh3 A G 11: 67,086,627 K368E probably benign Het
Myo16 T A 8: 10,322,656 N118K probably damaging Het
Myo5c A G 9: 75,249,761 S160G probably damaging Het
Nat1 A T 8: 67,491,001 I13F probably damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nwd1 T C 8: 72,704,994 S1207P probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1390 T C 11: 49,340,835 L101P probably damaging Het
Olfr153 T C 2: 87,532,824 S264P probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Paqr8 A T 1: 20,935,480 H286L probably damaging Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pes1 A G 11: 3,969,482 K52E probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Robo2 T C 16: 73,916,145 D1283G probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Slc2a4 C T 11: 69,945,007 V339I probably benign Het
Slc39a6 G A 18: 24,601,482 probably null Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Snx33 T C 9: 56,925,837 H316R probably benign Het
Spata31d1a T G 13: 59,702,007 D769A probably damaging Het
Stmn2 A T 3: 8,541,904 E28V probably damaging Het
Syt9 A G 7: 107,436,529 D251G probably damaging Het
Tjap1 T C 17: 46,262,421 T37A probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tprg A G 16: 25,412,891 T206A probably benign Het
Ttc37 A T 13: 76,113,047 R112S probably benign Het
Ttc37 A G 13: 76,130,235 Q556R probably benign Het
Ubqlnl A T 7: 104,150,065 M75K possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r12 C T 5: 109,092,076 G207E probably damaging Het
Xrn2 T G 2: 147,049,361 L697* probably null Het
Zfp764 A G 7: 127,405,039 F307L probably benign Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Zranb2 A T 3: 157,543,156 probably null Het
Other mutations in Tsta3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Tsta3 APN 15 75926185 missense probably damaging 0.99
IGL02674:Tsta3 APN 15 75926389 missense probably damaging 1.00
IGL02830:Tsta3 APN 15 75925588 missense probably benign 0.00
R0189:Tsta3 UTSW 15 75926978 missense probably damaging 1.00
R0671:Tsta3 UTSW 15 75928958 missense possibly damaging 0.61
R1878:Tsta3 UTSW 15 75925369 missense probably benign 0.12
R1886:Tsta3 UTSW 15 75926989 missense possibly damaging 0.89
R1912:Tsta3 UTSW 15 75925649 missense possibly damaging 0.81
R2116:Tsta3 UTSW 15 75926142 missense probably damaging 1.00
R2393:Tsta3 UTSW 15 75926351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGCGTATGAGTACCCG -3'
(R):5'- TAGAAGCGCTTCAAATCCATAGG -3'

Sequencing Primer
(F):5'- TGAGTACCCGAAATTGCTGC -3'
(R):5'- GCACAGATGGCACTCATATCTG -3'
Posted On2014-06-30