Incidental Mutation 'R1885:Ccdc80'
ID209491
Institutional Source Beutler Lab
Gene Symbol Ccdc80
Ensembl Gene ENSMUSG00000022665
Gene Namecoiled-coil domain containing 80
SynonymsDRO1, Urb, Ssg1, 2610001E17Rik
MMRRC Submission 039906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1885 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location45093402-45128077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45096720 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 613 (D613A)
Ref Sequence ENSEMBL: ENSMUSP00000097097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061050] [ENSMUST00000099498]
Predicted Effect probably benign
Transcript: ENSMUST00000061050
AA Change: D613A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000058752
Gene: ENSMUSG00000022665
AA Change: D613A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 141 270 2.2e-31 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 614 748 3.1e-36 PFAM
Pfam:DUF4174 770 901 2.1e-36 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099498
AA Change: D613A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097097
Gene: ENSMUSG00000022665
AA Change: D613A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 140 271 8.9e-34 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 613 749 1.4e-21 PFAM
Pfam:DUF4174 769 902 3.5e-39 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155800
Coding Region Coverage
  • 1x: 97.0%
  • 3x: 96.1%
  • 10x: 92.7%
  • 20x: 85.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased adiposity, hyperglycemia, glucose intolerance, impaired insulin secretion, and altered energy intake and expenditure when fed a high-fat diet. Mice homozygous for a different null allele develop thyroid adenomas and ovarian carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acox2 C T 14: 8,248,102 M393I probably benign Het
Adcy10 A G 1: 165,570,808 I1491M probably benign Het
Adcy3 T A 12: 4,134,951 V209E probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Apobec3 A T 15: 79,897,705 H82L probably damaging Het
Atg9b A T 5: 24,388,254 W384R probably damaging Het
Atp8a1 A G 5: 67,747,318 V506A possibly damaging Het
Atxn1 G T 13: 45,567,804 A205D probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B4galnt3 T C 6: 120,223,640 E223G probably damaging Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
C530008M17Rik A G 5: 76,856,742 T317A unknown Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Caprin2 A T 6: 148,877,885 probably null Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cebpz A T 17: 78,932,116 D625E probably benign Het
Coq6 C A 12: 84,372,464 N388K probably damaging Het
D430041D05Rik T C 2: 104,230,455 M1365V probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dpysl4 T G 7: 139,096,807 V391G probably damaging Het
Dyrk4 G T 6: 126,877,181 Q550K probably benign Het
Epas1 A G 17: 86,805,295 D107G probably damaging Het
Esrp2 A G 8: 106,131,821 V636A possibly damaging Het
Etl4 T A 2: 20,743,984 Y176N probably damaging Het
Etnppl T C 3: 130,629,462 V264A probably benign Het
Fer T A 17: 64,138,914 V790D probably damaging Het
Gdpd5 G A 7: 99,459,997 V575I probably benign Het
Gif G A 19: 11,752,324 A216T probably benign Het
Gipc3 T C 10: 81,341,347 I130V probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Iqsec3 G A 6: 121,428,367 probably benign Het
Kdm5d G T Y: 940,781 probably null Het
Kl A G 5: 150,953,494 R260G possibly damaging Het
Kras T C 6: 145,232,117 E143G probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Ksr1 T C 11: 79,036,521 T329A probably damaging Het
March6 A G 15: 31,502,806 V83A probably benign Het
Mettl2 T C 11: 105,131,620 I212T possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mlh1 C A 9: 111,258,556 S24I probably benign Het
Mmel1 G A 4: 154,890,876 R424Q possibly damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Myh3 A G 11: 67,086,627 K368E probably benign Het
Myo16 T A 8: 10,322,656 N118K probably damaging Het
Myo5c A G 9: 75,249,761 S160G probably damaging Het
Nat1 A T 8: 67,491,001 I13F probably damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nwd1 T C 8: 72,704,994 S1207P probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1390 T C 11: 49,340,835 L101P probably damaging Het
Olfr153 T C 2: 87,532,824 S264P probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Paqr8 A T 1: 20,935,480 H286L probably damaging Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pes1 A G 11: 3,969,482 K52E probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Robo2 T C 16: 73,916,145 D1283G probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Slc2a4 C T 11: 69,945,007 V339I probably benign Het
Slc39a6 G A 18: 24,601,482 probably null Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Snx33 T C 9: 56,925,837 H316R probably benign Het
Spata31d1a T G 13: 59,702,007 D769A probably damaging Het
Stmn2 A T 3: 8,541,904 E28V probably damaging Het
Syt9 A G 7: 107,436,529 D251G probably damaging Het
Tjap1 T C 17: 46,262,421 T37A probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tprg A G 16: 25,412,891 T206A probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc37 A T 13: 76,113,047 R112S probably benign Het
Ttc37 A G 13: 76,130,235 Q556R probably benign Het
Ubqlnl A T 7: 104,150,065 M75K possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r12 C T 5: 109,092,076 G207E probably damaging Het
Xrn2 T G 2: 147,049,361 L697* probably null Het
Zfp764 A G 7: 127,405,039 F307L probably benign Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Zranb2 A T 3: 157,543,156 probably null Het
Other mutations in Ccdc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Ccdc80 APN 16 45096264 missense probably benign 0.07
IGL01781:Ccdc80 APN 16 45126130 missense probably damaging 1.00
IGL01945:Ccdc80 APN 16 45118245 missense probably damaging 0.99
IGL02163:Ccdc80 APN 16 45096114 missense probably benign
IGL02223:Ccdc80 APN 16 45095603 missense probably damaging 1.00
IGL02573:Ccdc80 APN 16 45095589 missense probably damaging 1.00
IGL02675:Ccdc80 APN 16 45116332 missense probably damaging 1.00
IGL02689:Ccdc80 APN 16 45096409 nonsense probably null
R0219:Ccdc80 UTSW 16 45096483 missense probably damaging 1.00
R0383:Ccdc80 UTSW 16 45095369 missense probably damaging 1.00
R1537:Ccdc80 UTSW 16 45095936 missense probably benign 0.21
R1726:Ccdc80 UTSW 16 45096005 missense probably benign 0.04
R2021:Ccdc80 UTSW 16 45122912 missense probably damaging 1.00
R2140:Ccdc80 UTSW 16 45127446 missense probably damaging 1.00
R2186:Ccdc80 UTSW 16 45118105 missense probably damaging 1.00
R3896:Ccdc80 UTSW 16 45096621 missense probably benign 0.11
R3941:Ccdc80 UTSW 16 45096092 missense probably benign
R3971:Ccdc80 UTSW 16 45095820 missense probably benign 0.22
R4082:Ccdc80 UTSW 16 45122927 missense probably damaging 1.00
R4322:Ccdc80 UTSW 16 45095588 missense probably damaging 1.00
R4578:Ccdc80 UTSW 16 45095486 missense probably damaging 1.00
R4604:Ccdc80 UTSW 16 45095565 missense probably damaging 1.00
R4868:Ccdc80 UTSW 16 45104413 missense probably damaging 1.00
R4896:Ccdc80 UTSW 16 45095898 missense probably benign
R4921:Ccdc80 UTSW 16 45118167 missense probably damaging 1.00
R4979:Ccdc80 UTSW 16 45116287 missense possibly damaging 0.90
R5452:Ccdc80 UTSW 16 45118165 missense probably damaging 1.00
R5454:Ccdc80 UTSW 16 45127225 nonsense probably null
R5594:Ccdc80 UTSW 16 45116263 missense probably benign 0.00
R5661:Ccdc80 UTSW 16 45127445 missense probably damaging 1.00
R5701:Ccdc80 UTSW 16 45116378 missense possibly damaging 0.51
R6106:Ccdc80 UTSW 16 45096710 missense probably benign 0.00
R6393:Ccdc80 UTSW 16 45096465 missense possibly damaging 0.88
R6633:Ccdc80 UTSW 16 45094908 missense possibly damaging 0.95
R6943:Ccdc80 UTSW 16 45095082 missense probably benign 0.00
R7021:Ccdc80 UTSW 16 45104441 missense probably damaging 1.00
R7030:Ccdc80 UTSW 16 45122889 missense possibly damaging 0.60
R7208:Ccdc80 UTSW 16 45096710 missense probably benign 0.12
R7486:Ccdc80 UTSW 16 45126179 missense probably damaging 1.00
R7490:Ccdc80 UTSW 16 45096400 missense probably damaging 1.00
R7539:Ccdc80 UTSW 16 45095082 missense probably benign 0.01
R7562:Ccdc80 UTSW 16 45122903 missense probably damaging 1.00
X0012:Ccdc80 UTSW 16 45096425 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCGCAGAATGCCAAGGAGTC -3'
(R):5'- CACGTGTCTCTGAGTTTCACAAC -3'

Sequencing Primer
(F):5'- CTTGAAAAGCTCGAGAAACCTG -3'
(R):5'- GACCGACCTTGAACTGACCTTG -3'
Posted On2014-06-30