Mutagenetix > Incidental Mutation

Incidental Mutation 'R1886:Acacb'

209528

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

039907-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1886 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 114218959 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1317 (L1317Q)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably damaging
Transcript: ENSMUST00000031583
AA Change: L1317Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: L1317Q

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102582
AA Change: L1317Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: L1317Q

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Coding Region Coverage

1x: 97.2%
3x: 96.2%
10x: 93.1%
20x: 85.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	G	5: 98,801,831	N208S	probably benign	Het
1700102P08Rik	T	A	9: 108,393,610	D124E	possibly damaging	Het
Aarsd1	T	C	11: 101,411,401	T278A	probably benign	Het
Acsf3	T	C	8: 122,784,002	V293A	probably damaging	Het
Adora3	A	C	3: 105,904,836	N13H	possibly damaging	Het
Aen	A	T	7: 78,907,325	D307V	probably damaging	Het
Ahnak	G	A	19: 9,015,979	D4876N	probably damaging	Het
Ap2b1	T	A	11: 83,390,735	N822K	probably damaging	Het
Arhgdia	T	C	11: 120,579,418	D143G	probably benign	Het
AU022751	GTCATCATCATCATC	GTCATCATCATCATCATC	X: 6,082,591		probably benign	Het
Bcl9	G	T	3: 97,215,397	R29S	probably benign	Het
Bhmt2	T	A	13: 93,662,490	K274N	probably benign	Het
Brip1	C	A	11: 86,138,815	G631V	probably damaging	Het
Cacna1i	A	G	15: 80,358,944	E434G	probably damaging	Het
Ccdc81	T	C	7: 89,866,611	E620G	possibly damaging	Het
Cit	A	G	5: 115,933,486	Y584C	probably damaging	Het
Crebl2	T	C	6: 134,851,096	M77T	probably benign	Het
Dach2	G	A	X: 113,298,608	G61D	probably benign	Het
Ddx4	A	T	13: 112,622,665	D237E	probably damaging	Het
Dgcr8	A	G	16: 18,278,354	I490T	possibly damaging	Het
Dmxl1	G	A	18: 49,859,135	R316H	probably benign	Het
Dnah17	T	A	11: 118,108,161	I929F	possibly damaging	Het
Eif3f	A	G	7: 108,940,751	T289A	probably benign	Het
Ercc5	A	T	1: 44,175,976	K890*	probably null	Het
Esrp2	A	T	8: 106,133,857	V247E	probably damaging	Het
Evpl	C	T	11: 116,227,576	G735E	probably damaging	Het
Fbxl21	A	G	13: 56,527,093	I60V	probably benign	Het
Frem3	A	G	8: 80,613,885	I936V	probably benign	Het
Fsd1l	T	C	4: 53,696,984		probably null	Het
Gad1-ps	T	C	10: 99,445,582		noncoding transcript	Het
Gbp2b	A	G	3: 142,608,302	T448A	probably benign	Het
Gm11397	C	T	13: 33,404,220	R263C	possibly damaging	Het
Gm281	A	C	14: 13,828,607	Y718D	probably damaging	Het
Gm7102	A	G	19: 61,175,698	F100L	probably damaging	Het
Gmppa	T	C	1: 75,442,508	V353A	probably damaging	Het
Hmcn1	T	C	1: 150,577,295	E5423G	probably benign	Het
Hmgxb3	A	G	18: 61,137,401		probably null	Het
Krt12	T	C	11: 99,418,576	D286G	probably damaging	Het
Krt75	A	T	15: 101,571,097	M266K	probably damaging	Het
Ksr1	C	A	11: 79,020,378	V11F	probably null	Het
Lag3	T	C	6: 124,909,439	N184D	probably damaging	Het
Lsm10	C	G	4: 126,097,948	D32E	probably benign	Het
Mettl5	A	G	2: 69,880,805	V123A	probably damaging	Het
Mfrp	A	G	9: 44,103,488	D274G	possibly damaging	Het
Mgat3	A	G	15: 80,211,619	I216V	probably benign	Het
Mkrn3	G	A	7: 62,418,738	A435V	probably benign	Het
Mob3a	G	A	10: 80,691,234	Q86*	probably null	Het
Mttp	A	T	3: 138,092,615	V840D	probably damaging	Het
Nadk2	A	C	15: 9,103,358	N308H	possibly damaging	Het
Ncoa7	T	C	10: 30,648,452	N823S	possibly damaging	Het
Nlk	T	A	11: 78,586,928	I330F	probably damaging	Het
Ofcc1	T	C	13: 40,206,624	S310G	possibly damaging	Het
Olfr480	T	C	7: 108,066,778	N7D	probably benign	Het
Olfr498	A	T	7: 108,465,740	M139L	probably benign	Het
Orc2	T	C	1: 58,471,088		probably null	Het
Orc3	A	G	4: 34,584,829	Y459H	probably damaging	Het
Pah	T	A	10: 87,528,328	N30K	possibly damaging	Het
Pcsk4	T	C	10: 80,328,960	K74E	probably benign	Het
Pdlim7	C	T	13: 55,506,168	G212D	probably benign	Het
Pfkm	A	G	15: 98,127,746	N547S	probably damaging	Het
Por	A	G	5: 135,734,274	E546G	probably damaging	Het
Ppp1r13l	T	C	7: 19,377,571	S774P	probably damaging	Het
Prdm1	T	A	10: 44,439,758	D794V	probably damaging	Het
Prdx5	A	G	19: 6,908,190	I32T	probably benign	Het
Prlhr	G	T	19: 60,467,494	C211*	probably null	Het
Ripk3	C	T	14: 55,788,237		probably null	Het
Rmnd5b	G	A	11: 51,627,638	A137V	probably damaging	Het
Rwdd2b	A	T	16: 87,437,125	F72I	probably benign	Het
Scml4	A	G	10: 42,912,227	Y51C	probably damaging	Het
Sept1	A	G	7: 127,214,765		probably benign	Het
Slc30a10	T	A	1: 185,462,864	I291N	probably damaging	Het
Slc7a9	T	G	7: 35,453,402	C20W	possibly damaging	Het
Slc7a9	G	C	7: 35,453,403	A21P	probably damaging	Het
Slco1b2	A	T	6: 141,683,225	Y551F	probably damaging	Het
Sra1	T	C	18: 36,668,777	M87V	probably benign	Het
Syvn1	T	C	19: 6,049,227	S169P	possibly damaging	Het
Tmc7	A	T	7: 118,561,087	F176I	possibly damaging	Het
Tmem62	A	T	2: 120,986,670	I236F	probably damaging	Het
Trip4	T	A	9: 65,874,881	I190F	probably null	Het
Trpa1	T	C	1: 14,889,425	D679G	probably benign	Het
Tsta3	G	T	15: 75,926,989	T123N	possibly damaging	Het
Ttc22	T	A	4: 106,636,866		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tyrp1	T	A	4: 80,840,806		probably null	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Usp36	A	T	11: 118,272,958	Y255N	probably damaging	Het
Zfp944	A	T	17: 22,339,979	Y96N	probably benign	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTTCGTGTAACTTAGAGAGCCTG -3'
(R):5'- ATTCAAGGCAGCACTTGTGG -3'

Sequencing Primer
(F):5'- CCTGCAGCTGCCCTGTG -3'
(R):5'- TCCCTGACAGGAGATGACACTG -3'

Posted On

2014-06-30