Incidental Mutation 'R1886:Acacb'
ID 209528
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 039907-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1886 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114357020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1317 (L1317Q)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably damaging
Transcript: ENSMUST00000031583
AA Change: L1317Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: L1317Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102582
AA Change: L1317Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: L1317Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.2%
  • 10x: 93.1%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,270,809 (GRCm39) D124E possibly damaging Het
Aarsd1 T C 11: 101,302,227 (GRCm39) T278A probably benign Het
Acsf3 T C 8: 123,510,741 (GRCm39) V293A probably damaging Het
Adora3 A C 3: 105,812,152 (GRCm39) N13H possibly damaging Het
Aen A T 7: 78,557,073 (GRCm39) D307V probably damaging Het
Ahnak G A 19: 8,993,343 (GRCm39) D4876N probably damaging Het
Ap2b1 T A 11: 83,281,561 (GRCm39) N822K probably damaging Het
Arhgdia T C 11: 120,470,244 (GRCm39) D143G probably benign Het
Bcl9 G T 3: 97,122,713 (GRCm39) R29S probably benign Het
Bhmt2 T A 13: 93,798,998 (GRCm39) K274N probably benign Het
Brip1 C A 11: 86,029,641 (GRCm39) G631V probably damaging Het
Cacna1i A G 15: 80,243,145 (GRCm39) E434G probably damaging Het
Ccdc81 T C 7: 89,515,819 (GRCm39) E620G possibly damaging Het
Cdhr18 A C 14: 13,828,607 (GRCm38) Y718D probably damaging Het
Cfap299 A G 5: 98,949,690 (GRCm39) N208S probably benign Het
Cit A G 5: 116,071,545 (GRCm39) Y584C probably damaging Het
Crebl2 T C 6: 134,828,059 (GRCm39) M77T probably benign Het
Dach2 G A X: 112,208,305 (GRCm39) G61D probably benign Het
Ddx4 A T 13: 112,759,199 (GRCm39) D237E probably damaging Het
Dgcr8 A G 16: 18,096,218 (GRCm39) I490T possibly damaging Het
Dmxl1 G A 18: 49,992,202 (GRCm39) R316H probably benign Het
Dnah17 T A 11: 117,998,987 (GRCm39) I929F possibly damaging Het
Eif3f A G 7: 108,539,958 (GRCm39) T289A probably benign Het
Ercc5 A T 1: 44,215,136 (GRCm39) K890* probably null Het
Esrp2 A T 8: 106,860,489 (GRCm39) V247E probably damaging Het
Evpl C T 11: 116,118,402 (GRCm39) G735E probably damaging Het
Ezhip GTCATCATCATCATC GTCATCATCATCATCATC X: 5,994,645 (GRCm39) probably benign Het
Fbxl21 A G 13: 56,674,906 (GRCm39) I60V probably benign Het
Frem3 A G 8: 81,340,514 (GRCm39) I936V probably benign Het
Fsd1l T C 4: 53,696,984 (GRCm39) probably null Het
Gad1-ps T C 10: 99,281,444 (GRCm39) noncoding transcript Het
Gbp2b A G 3: 142,314,063 (GRCm39) T448A probably benign Het
Gfus G T 15: 75,798,838 (GRCm39) T123N possibly damaging Het
Gmppa T C 1: 75,419,152 (GRCm39) V353A probably damaging Het
Hmcn1 T C 1: 150,453,046 (GRCm39) E5423G probably benign Het
Hmgxb3 A G 18: 61,270,473 (GRCm39) probably null Het
Krt12 T C 11: 99,309,402 (GRCm39) D286G probably damaging Het
Krt75 A T 15: 101,479,532 (GRCm39) M266K probably damaging Het
Ksr1 C A 11: 78,911,204 (GRCm39) V11F probably null Het
Lag3 T C 6: 124,886,402 (GRCm39) N184D probably damaging Het
Lsm10 C G 4: 125,991,741 (GRCm39) D32E probably benign Het
Mettl5 A G 2: 69,711,149 (GRCm39) V123A probably damaging Het
Mfrp A G 9: 44,014,785 (GRCm39) D274G possibly damaging Het
Mgat3 A G 15: 80,095,820 (GRCm39) I216V probably benign Het
Mkrn3 G A 7: 62,068,486 (GRCm39) A435V probably benign Het
Mob3a G A 10: 80,527,068 (GRCm39) Q86* probably null Het
Mplkipl1 A G 19: 61,164,136 (GRCm39) F100L probably damaging Het
Mttp A T 3: 137,798,376 (GRCm39) V840D probably damaging Het
Nadk2 A C 15: 9,103,446 (GRCm39) N308H possibly damaging Het
Ncoa7 T C 10: 30,524,448 (GRCm39) N823S possibly damaging Het
Nlk T A 11: 78,477,754 (GRCm39) I330F probably damaging Het
Ofcc1 T C 13: 40,360,100 (GRCm39) S310G possibly damaging Het
Or5p57 T C 7: 107,665,985 (GRCm39) N7D probably benign Het
Or5p73 A T 7: 108,064,947 (GRCm39) M139L probably benign Het
Orc2 T C 1: 58,510,247 (GRCm39) probably null Het
Orc3 A G 4: 34,584,829 (GRCm39) Y459H probably damaging Het
Pah T A 10: 87,364,190 (GRCm39) N30K possibly damaging Het
Pcsk4 T C 10: 80,164,794 (GRCm39) K74E probably benign Het
Pdlim7 C T 13: 55,653,981 (GRCm39) G212D probably benign Het
Pfkm A G 15: 98,025,627 (GRCm39) N547S probably damaging Het
Por A G 5: 135,763,128 (GRCm39) E546G probably damaging Het
Ppp1r13l T C 7: 19,111,496 (GRCm39) S774P probably damaging Het
Prdm1 T A 10: 44,315,754 (GRCm39) D794V probably damaging Het
Prdx5 A G 19: 6,885,558 (GRCm39) I32T probably benign Het
Prlhr G T 19: 60,455,932 (GRCm39) C211* probably null Het
Ripk3 C T 14: 56,025,694 (GRCm39) probably null Het
Rmnd5b G A 11: 51,518,465 (GRCm39) A137V probably damaging Het
Rwdd2b A T 16: 87,234,013 (GRCm39) F72I probably benign Het
Scml4 A G 10: 42,788,223 (GRCm39) Y51C probably damaging Het
Septin1 A G 7: 126,813,937 (GRCm39) probably benign Het
Serpinb9h C T 13: 33,588,203 (GRCm39) R263C possibly damaging Het
Slc30a10 T A 1: 185,195,061 (GRCm39) I291N probably damaging Het
Slc7a9 T G 7: 35,152,827 (GRCm39) C20W possibly damaging Het
Slc7a9 G C 7: 35,152,828 (GRCm39) A21P probably damaging Het
Slco1b2 A T 6: 141,628,951 (GRCm39) Y551F probably damaging Het
Sra1 T C 18: 36,801,830 (GRCm39) M87V probably benign Het
Syvn1 T C 19: 6,099,257 (GRCm39) S169P possibly damaging Het
Tmc7 A T 7: 118,160,310 (GRCm39) F176I possibly damaging Het
Tmem62 A T 2: 120,817,151 (GRCm39) I236F probably damaging Het
Trip4 T A 9: 65,782,163 (GRCm39) I190F probably null Het
Trpa1 T C 1: 14,959,649 (GRCm39) D679G probably benign Het
Ttc22 T A 4: 106,494,063 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tyrp1 T A 4: 80,759,043 (GRCm39) probably null Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Usp36 A T 11: 118,163,784 (GRCm39) Y255N probably damaging Het
Zfp944 A T 17: 22,558,960 (GRCm39) Y96N probably benign Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTCGTGTAACTTAGAGAGCCTG -3'
(R):5'- ATTCAAGGCAGCACTTGTGG -3'

Sequencing Primer
(F):5'- CCTGCAGCTGCCCTGTG -3'
(R):5'- TCCCTGACAGGAGATGACACTG -3'
Posted On 2014-06-30