Incidental Mutation 'R1886:Por'
ID209530
Institutional Source Beutler Lab
Gene Symbol Por
Ensembl Gene ENSMUSG00000005514
Gene NameP450 (cytochrome) oxidoreductase
SynonymsNADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
MMRRC Submission 039907-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1886 (G1)
Quality Score138
Status Not validated
Chromosome5
Chromosomal Location135670033-135735326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135734274 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 546 (E546G)
Ref Sequence ENSEMBL: ENSMUSP00000112924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005651] [ENSMUST00000043378] [ENSMUST00000122113] [ENSMUST00000127096] [ENSMUST00000153399] [ENSMUST00000153500] [ENSMUST00000153515]
Predicted Effect probably damaging
Transcript: ENSMUST00000005651
AA Change: E546G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005651
Gene: ENSMUSG00000005514
AA Change: E546G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 1.6e-40 PFAM
Pfam:FAD_binding_1 274 493 1.3e-84 PFAM
Pfam:NAD_binding_1 530 642 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043378
SMART Domains Protein: ENSMUSP00000045252
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 13 336 4.2e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122113
AA Change: E546G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112924
Gene: ENSMUSG00000005514
AA Change: E546G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 2.6e-40 PFAM
Pfam:FAD_binding_1 274 493 5.1e-87 PFAM
Pfam:NAD_binding_1 530 605 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127096
SMART Domains Protein: ENSMUSP00000119138
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Flavodoxin_1 127 168 5.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149684
Predicted Effect probably benign
Transcript: ENSMUST00000153399
SMART Domains Protein: ENSMUSP00000120834
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 12 93 9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153500
SMART Domains Protein: ENSMUSP00000121531
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 5.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153515
SMART Domains Protein: ENSMUSP00000121022
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 3.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199952
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.2%
  • 10x: 93.1%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects of the neural tube, eye, heart, and limbs, retarded growth, and prenatal lethality. Liver-specific knockouts exhibit increased liver weight, hepatic lipidosis, and impaired drug metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,801,831 N208S probably benign Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acacb T A 5: 114,218,959 L1317Q probably damaging Het
Acsf3 T C 8: 122,784,002 V293A probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
Ahnak G A 19: 9,015,979 D4876N probably damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Arhgdia T C 11: 120,579,418 D143G probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bcl9 G T 3: 97,215,397 R29S probably benign Het
Bhmt2 T A 13: 93,662,490 K274N probably benign Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cit A G 5: 115,933,486 Y584C probably damaging Het
Crebl2 T C 6: 134,851,096 M77T probably benign Het
Dach2 G A X: 113,298,608 G61D probably benign Het
Ddx4 A T 13: 112,622,665 D237E probably damaging Het
Dgcr8 A G 16: 18,278,354 I490T possibly damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Dnah17 T A 11: 118,108,161 I929F possibly damaging Het
Eif3f A G 7: 108,940,751 T289A probably benign Het
Ercc5 A T 1: 44,175,976 K890* probably null Het
Esrp2 A T 8: 106,133,857 V247E probably damaging Het
Evpl C T 11: 116,227,576 G735E probably damaging Het
Fbxl21 A G 13: 56,527,093 I60V probably benign Het
Frem3 A G 8: 80,613,885 I936V probably benign Het
Fsd1l T C 4: 53,696,984 probably null Het
Gad1-ps T C 10: 99,445,582 noncoding transcript Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gm11397 C T 13: 33,404,220 R263C possibly damaging Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Gm7102 A G 19: 61,175,698 F100L probably damaging Het
Gmppa T C 1: 75,442,508 V353A probably damaging Het
Hmcn1 T C 1: 150,577,295 E5423G probably benign Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Krt12 T C 11: 99,418,576 D286G probably damaging Het
Krt75 A T 15: 101,571,097 M266K probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Lag3 T C 6: 124,909,439 N184D probably damaging Het
Lsm10 C G 4: 126,097,948 D32E probably benign Het
Mettl5 A G 2: 69,880,805 V123A probably damaging Het
Mfrp A G 9: 44,103,488 D274G possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mttp A T 3: 138,092,615 V840D probably damaging Het
Nadk2 A C 15: 9,103,358 N308H possibly damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nlk T A 11: 78,586,928 I330F probably damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Olfr498 A T 7: 108,465,740 M139L probably benign Het
Orc2 T C 1: 58,471,088 probably null Het
Orc3 A G 4: 34,584,829 Y459H probably damaging Het
Pah T A 10: 87,528,328 N30K possibly damaging Het
Pcsk4 T C 10: 80,328,960 K74E probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pfkm A G 15: 98,127,746 N547S probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Prdm1 T A 10: 44,439,758 D794V probably damaging Het
Prdx5 A G 19: 6,908,190 I32T probably benign Het
Prlhr G T 19: 60,467,494 C211* probably null Het
Ripk3 C T 14: 55,788,237 probably null Het
Rmnd5b G A 11: 51,627,638 A137V probably damaging Het
Rwdd2b A T 16: 87,437,125 F72I probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Sept1 A G 7: 127,214,765 probably benign Het
Slc30a10 T A 1: 185,462,864 I291N probably damaging Het
Slc7a9 T G 7: 35,453,402 C20W possibly damaging Het
Slc7a9 G C 7: 35,453,403 A21P probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Sra1 T C 18: 36,668,777 M87V probably benign Het
Syvn1 T C 19: 6,049,227 S169P possibly damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tmem62 A T 2: 120,986,670 I236F probably damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Trpa1 T C 1: 14,889,425 D679G probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc22 T A 4: 106,636,866 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyrp1 T A 4: 80,840,806 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp36 A T 11: 118,272,958 Y255N probably damaging Het
Zfp944 A T 17: 22,339,979 Y96N probably benign Het
Other mutations in Por
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Por APN 5 135734186 nonsense probably null
IGL02126:Por APN 5 135715975 missense probably benign 0.00
R0201:Por UTSW 5 135731178 missense possibly damaging 0.94
R0355:Por UTSW 5 135732584 missense probably benign 0.38
R1755:Por UTSW 5 135729485 nonsense probably null
R4057:Por UTSW 5 135731574 missense probably damaging 1.00
R4282:Por UTSW 5 135715961 missense possibly damaging 0.48
R4761:Por UTSW 5 135725930 intron probably benign
R5057:Por UTSW 5 135730902 missense probably damaging 1.00
R5064:Por UTSW 5 135733795 missense probably benign 0.23
R5159:Por UTSW 5 135730917 missense probably benign 0.38
R5580:Por UTSW 5 135733821 missense probably damaging 0.98
R5895:Por UTSW 5 135715984 missense probably benign 0.03
R7225:Por UTSW 5 135732587 missense probably benign
R7422:Por UTSW 5 135734919 missense probably benign 0.06
R7461:Por UTSW 5 135729504 missense probably damaging 0.99
R7488:Por UTSW 5 135733644 missense probably benign 0.00
R7613:Por UTSW 5 135729504 missense probably damaging 0.99
R7649:Por UTSW 5 135734505 missense probably damaging 0.99
R7736:Por UTSW 5 135731122 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGAAGTCTGGACGAGTGAAC -3'
(R):5'- CACATTAAGCTGCGTGAGGG -3'

Sequencing Primer
(F):5'- TGAACAAGGGGGTGGCCAC -3'
(R):5'- TCCTCGCGGTACAGATAGTC -3'
Posted On2014-06-30