Incidental Mutation 'R1886:Frem3'
ID209548
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission 039907-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1886 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80613885 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 936 (I936V)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably benign
Transcript: ENSMUST00000039695
AA Change: I936V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: I936V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.2%
  • 10x: 93.1%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,801,831 N208S probably benign Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acacb T A 5: 114,218,959 L1317Q probably damaging Het
Acsf3 T C 8: 122,784,002 V293A probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
Ahnak G A 19: 9,015,979 D4876N probably damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Arhgdia T C 11: 120,579,418 D143G probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bcl9 G T 3: 97,215,397 R29S probably benign Het
Bhmt2 T A 13: 93,662,490 K274N probably benign Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cit A G 5: 115,933,486 Y584C probably damaging Het
Crebl2 T C 6: 134,851,096 M77T probably benign Het
Dach2 G A X: 113,298,608 G61D probably benign Het
Ddx4 A T 13: 112,622,665 D237E probably damaging Het
Dgcr8 A G 16: 18,278,354 I490T possibly damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Dnah17 T A 11: 118,108,161 I929F possibly damaging Het
Eif3f A G 7: 108,940,751 T289A probably benign Het
Ercc5 A T 1: 44,175,976 K890* probably null Het
Esrp2 A T 8: 106,133,857 V247E probably damaging Het
Evpl C T 11: 116,227,576 G735E probably damaging Het
Fbxl21 A G 13: 56,527,093 I60V probably benign Het
Fsd1l T C 4: 53,696,984 probably null Het
Gad1-ps T C 10: 99,445,582 noncoding transcript Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gm11397 C T 13: 33,404,220 R263C possibly damaging Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Gm7102 A G 19: 61,175,698 F100L probably damaging Het
Gmppa T C 1: 75,442,508 V353A probably damaging Het
Hmcn1 T C 1: 150,577,295 E5423G probably benign Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Krt12 T C 11: 99,418,576 D286G probably damaging Het
Krt75 A T 15: 101,571,097 M266K probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Lag3 T C 6: 124,909,439 N184D probably damaging Het
Lsm10 C G 4: 126,097,948 D32E probably benign Het
Mettl5 A G 2: 69,880,805 V123A probably damaging Het
Mfrp A G 9: 44,103,488 D274G possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mttp A T 3: 138,092,615 V840D probably damaging Het
Nadk2 A C 15: 9,103,358 N308H possibly damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nlk T A 11: 78,586,928 I330F probably damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Olfr498 A T 7: 108,465,740 M139L probably benign Het
Orc2 T C 1: 58,471,088 probably null Het
Orc3 A G 4: 34,584,829 Y459H probably damaging Het
Pah T A 10: 87,528,328 N30K possibly damaging Het
Pcsk4 T C 10: 80,328,960 K74E probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pfkm A G 15: 98,127,746 N547S probably damaging Het
Por A G 5: 135,734,274 E546G probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Prdm1 T A 10: 44,439,758 D794V probably damaging Het
Prdx5 A G 19: 6,908,190 I32T probably benign Het
Prlhr G T 19: 60,467,494 C211* probably null Het
Ripk3 C T 14: 55,788,237 probably null Het
Rmnd5b G A 11: 51,627,638 A137V probably damaging Het
Rwdd2b A T 16: 87,437,125 F72I probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Sept1 A G 7: 127,214,765 probably benign Het
Slc30a10 T A 1: 185,462,864 I291N probably damaging Het
Slc7a9 T G 7: 35,453,402 C20W possibly damaging Het
Slc7a9 G C 7: 35,453,403 A21P probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Sra1 T C 18: 36,668,777 M87V probably benign Het
Syvn1 T C 19: 6,049,227 S169P possibly damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tmem62 A T 2: 120,986,670 I236F probably damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Trpa1 T C 1: 14,889,425 D679G probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc22 T A 4: 106,636,866 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyrp1 T A 4: 80,840,806 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp36 A T 11: 118,272,958 Y255N probably damaging Het
Zfp944 A T 17: 22,339,979 Y96N probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 splice site probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R7976:Frem3 UTSW 8 80611602 nonsense probably null
R8171:Frem3 UTSW 8 80615240 missense probably damaging 1.00
R8185:Frem3 UTSW 8 80612304 nonsense probably null
R8306:Frem3 UTSW 8 80612211 missense possibly damaging 0.95
R8478:Frem3 UTSW 8 80611558 missense probably damaging 1.00
R8518:Frem3 UTSW 8 80612595 missense probably damaging 1.00
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CAGGAGAATCATTTATGCTAGCTGATG -3'
(R):5'- TGTGAACATAGCTGACTGCCC -3'

Sequencing Primer
(F):5'- CTGATGTTATCAATGGGAGCATCTC -3'
(R):5'- ACTTGCTCTGCAGGCCAAC -3'
Posted On2014-06-30