Incidental Mutation 'R1886:Ncoa7'
ID209556
Institutional Source Beutler Lab
Gene Symbol Ncoa7
Ensembl Gene ENSMUSG00000039697
Gene Namenuclear receptor coactivator 7
Synonyms9030406N13Rik
MMRRC Submission 039907-MU
Accession Numbers

Genbank: NM_172495; MGI: 2444847

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1886 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location30628999-30803326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30648452 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 823 (N823S)
Ref Sequence ENSEMBL: ENSMUSP00000150021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068567] [ENSMUST00000092610] [ENSMUST00000213836] [ENSMUST00000213897] [ENSMUST00000215740] [ENSMUST00000215926] [ENSMUST00000216172] [ENSMUST00000217138] [ENSMUST00000217644]
Predicted Effect probably benign
Transcript: ENSMUST00000068567
AA Change: N872S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000066741
Gene: ENSMUSG00000039697
AA Change: N872S

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
LysM 118 161 2.24e-7 SMART
low complexity region 165 176 N/A INTRINSIC
TLDc 781 943 2.86e-64 SMART
Predicted Effect unknown
Transcript: ENSMUST00000092610
AA Change: N150S
SMART Domains Protein: ENSMUSP00000090273
Gene: ENSMUSG00000039697
AA Change: N150S

DomainStartEndE-ValueType
TLDc 59 221 2.86e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213836
AA Change: N861S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213889
Predicted Effect probably benign
Transcript: ENSMUST00000213897
AA Change: N150S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215740
AA Change: N872S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215926
AA Change: N823S

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000216172
AA Change: N150S

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000217138
AA Change: N150S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000217644
AA Change: N150S

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.2%
  • 10x: 93.1%
  • 20x: 85.9%
Validation Efficiency
Allele List at MGI

All alleles(108) : Gene trapped(108)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,801,831 N208S probably benign Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acacb T A 5: 114,218,959 L1317Q probably damaging Het
Acsf3 T C 8: 122,784,002 V293A probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
Ahnak G A 19: 9,015,979 D4876N probably damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Arhgdia T C 11: 120,579,418 D143G probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bcl9 G T 3: 97,215,397 R29S probably benign Het
Bhmt2 T A 13: 93,662,490 K274N probably benign Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cit A G 5: 115,933,486 Y584C probably damaging Het
Crebl2 T C 6: 134,851,096 M77T probably benign Het
Dach2 G A X: 113,298,608 G61D probably benign Het
Ddx4 A T 13: 112,622,665 D237E probably damaging Het
Dgcr8 A G 16: 18,278,354 I490T possibly damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Dnah17 T A 11: 118,108,161 I929F possibly damaging Het
Eif3f A G 7: 108,940,751 T289A probably benign Het
Ercc5 A T 1: 44,175,976 K890* probably null Het
Esrp2 A T 8: 106,133,857 V247E probably damaging Het
Evpl C T 11: 116,227,576 G735E probably damaging Het
Fbxl21 A G 13: 56,527,093 I60V probably benign Het
Frem3 A G 8: 80,613,885 I936V probably benign Het
Fsd1l T C 4: 53,696,984 probably null Het
Gad1-ps T C 10: 99,445,582 noncoding transcript Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gm11397 C T 13: 33,404,220 R263C possibly damaging Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Gm7102 A G 19: 61,175,698 F100L probably damaging Het
Gmppa T C 1: 75,442,508 V353A probably damaging Het
Hmcn1 T C 1: 150,577,295 E5423G probably benign Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Krt12 T C 11: 99,418,576 D286G probably damaging Het
Krt75 A T 15: 101,571,097 M266K probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Lag3 T C 6: 124,909,439 N184D probably damaging Het
Lsm10 C G 4: 126,097,948 D32E probably benign Het
Mettl5 A G 2: 69,880,805 V123A probably damaging Het
Mfrp A G 9: 44,103,488 D274G possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mttp A T 3: 138,092,615 V840D probably damaging Het
Nadk2 A C 15: 9,103,358 N308H possibly damaging Het
Nlk T A 11: 78,586,928 I330F probably damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Olfr498 A T 7: 108,465,740 M139L probably benign Het
Orc2 T C 1: 58,471,088 probably null Het
Orc3 A G 4: 34,584,829 Y459H probably damaging Het
Pah T A 10: 87,528,328 N30K possibly damaging Het
Pcsk4 T C 10: 80,328,960 K74E probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pfkm A G 15: 98,127,746 N547S probably damaging Het
Por A G 5: 135,734,274 E546G probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Prdm1 T A 10: 44,439,758 D794V probably damaging Het
Prdx5 A G 19: 6,908,190 I32T probably benign Het
Prlhr G T 19: 60,467,494 C211* probably null Het
Ripk3 C T 14: 55,788,237 probably null Het
Rmnd5b G A 11: 51,627,638 A137V probably damaging Het
Rwdd2b A T 16: 87,437,125 F72I probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Sept1 A G 7: 127,214,765 probably benign Het
Slc30a10 T A 1: 185,462,864 I291N probably damaging Het
Slc7a9 T G 7: 35,453,402 C20W possibly damaging Het
Slc7a9 G C 7: 35,453,403 A21P probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Sra1 T C 18: 36,668,777 M87V probably benign Het
Syvn1 T C 19: 6,049,227 S169P possibly damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tmem62 A T 2: 120,986,670 I236F probably damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Trpa1 T C 1: 14,889,425 D679G probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc22 T A 4: 106,636,866 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tyrp1 T A 4: 80,840,806 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Usp36 A T 11: 118,272,958 Y255N probably damaging Het
Zfp944 A T 17: 22,339,979 Y96N probably benign Het
Other mutations in Ncoa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ncoa7 APN 10 30690840 missense probably damaging 1.00
IGL01716:Ncoa7 APN 10 30662334 missense probably damaging 0.96
IGL02114:Ncoa7 APN 10 30662364 missense probably damaging 1.00
IGL02170:Ncoa7 APN 10 30689853 missense possibly damaging 0.94
IGL02436:Ncoa7 APN 10 30694147 missense probably damaging 1.00
IGL02499:Ncoa7 APN 10 30690889 missense probably benign 0.04
IGL02533:Ncoa7 APN 10 30690899 missense possibly damaging 0.87
IGL02533:Ncoa7 APN 10 30722785 missense probably damaging 1.00
IGL02590:Ncoa7 APN 10 30694163 missense probably damaging 1.00
IGL02657:Ncoa7 APN 10 30652976 missense probably damaging 1.00
IGL03065:Ncoa7 APN 10 30647997 missense probably damaging 1.00
IGL03088:Ncoa7 APN 10 30698125 splice site probably null
IGL03090:Ncoa7 APN 10 30662400 missense probably damaging 0.96
IGL03196:Ncoa7 APN 10 30647514 utr 3 prime probably benign
D6062:Ncoa7 UTSW 10 30722655 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0578:Ncoa7 UTSW 10 30701917 critical splice donor site probably null
R0729:Ncoa7 UTSW 10 30691579 missense probably benign 0.00
R1538:Ncoa7 UTSW 10 30694211 missense probably damaging 0.99
R1539:Ncoa7 UTSW 10 30771729 missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30694101 missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30694101 missense probably damaging 1.00
R1624:Ncoa7 UTSW 10 30704659 missense possibly damaging 0.87
R1639:Ncoa7 UTSW 10 30701992 missense probably damaging 1.00
R1655:Ncoa7 UTSW 10 30698245 critical splice acceptor site probably null
R1876:Ncoa7 UTSW 10 30698126 intron probably benign
R1885:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1887:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1909:Ncoa7 UTSW 10 30689800 missense probably damaging 1.00
R1938:Ncoa7 UTSW 10 30698170 missense probably benign 0.02
R1965:Ncoa7 UTSW 10 30654430 nonsense probably null
R1978:Ncoa7 UTSW 10 30691299 missense probably benign
R2303:Ncoa7 UTSW 10 30654435 missense probably damaging 1.00
R3777:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R3778:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R4026:Ncoa7 UTSW 10 30722724 missense probably benign 0.02
R4230:Ncoa7 UTSW 10 30698257 splice site probably null
R4667:Ncoa7 UTSW 10 30690790 missense probably damaging 1.00
R4786:Ncoa7 UTSW 10 30655642 missense probably benign 0.28
R4809:Ncoa7 UTSW 10 30771762 missense possibly damaging 0.92
R4820:Ncoa7 UTSW 10 30648476 missense probably damaging 1.00
R4839:Ncoa7 UTSW 10 30722659 missense possibly damaging 0.93
R4861:Ncoa7 UTSW 10 30704612 missense probably benign
R4861:Ncoa7 UTSW 10 30704612 missense probably benign
R5271:Ncoa7 UTSW 10 30722729 missense probably benign 0.02
R5384:Ncoa7 UTSW 10 30722817 missense probably benign 0.00
R5418:Ncoa7 UTSW 10 30648039 missense probably damaging 1.00
R5964:Ncoa7 UTSW 10 30704636 missense probably damaging 1.00
R6257:Ncoa7 UTSW 10 30694177 missense probably damaging 1.00
R6683:Ncoa7 UTSW 10 30771721 missense probably damaging 0.99
R6813:Ncoa7 UTSW 10 30696192 missense probably damaging 1.00
R6910:Ncoa7 UTSW 10 30694121 missense possibly damaging 0.89
R7123:Ncoa7 UTSW 10 30654439 missense probably benign 0.28
R7327:Ncoa7 UTSW 10 30689800 missense probably damaging 1.00
R7412:Ncoa7 UTSW 10 30722851 missense possibly damaging 0.94
R7638:Ncoa7 UTSW 10 30722798 missense probably benign 0.35
R7653:Ncoa7 UTSW 10 30694243 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCTTGTGCTGGGTTTC -3'
(R):5'- ACATGGGTTCCAGTTAGAGC -3'

Sequencing Primer
(F):5'- TCTAAGCTGTCTGTATGCTTCAG -3'
(R):5'- TTGCTGAAAGAGTTATAAGATCCAAG -3'
Posted On2014-06-30