Incidental Mutation 'R1886:Ncoa7'
ID 209556
Institutional Source Beutler Lab
Gene Symbol Ncoa7
Ensembl Gene ENSMUSG00000039697
Gene Name nuclear receptor coactivator 7
Synonyms 9030406N13Rik
MMRRC Submission 039907-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1886 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 30521578-30683401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30524448 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 823 (N823S)
Ref Sequence ENSEMBL: ENSMUSP00000150021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068567] [ENSMUST00000092610] [ENSMUST00000213836] [ENSMUST00000213897] [ENSMUST00000215740] [ENSMUST00000217138] [ENSMUST00000216172] [ENSMUST00000215926] [ENSMUST00000217644]
AlphaFold Q6DFV7
Predicted Effect probably benign
Transcript: ENSMUST00000068567
AA Change: N872S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000066741
Gene: ENSMUSG00000039697
AA Change: N872S

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
LysM 118 161 2.24e-7 SMART
low complexity region 165 176 N/A INTRINSIC
TLDc 781 943 2.86e-64 SMART
Predicted Effect unknown
Transcript: ENSMUST00000092610
AA Change: N150S
SMART Domains Protein: ENSMUSP00000090273
Gene: ENSMUSG00000039697
AA Change: N150S

DomainStartEndE-ValueType
TLDc 59 221 2.86e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213836
AA Change: N861S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213889
Predicted Effect probably benign
Transcript: ENSMUST00000213897
AA Change: N150S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215740
AA Change: N872S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000217138
AA Change: N150S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216172
AA Change: N150S

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215926
AA Change: N823S

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000217644
AA Change: N150S

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.2%
  • 10x: 93.1%
  • 20x: 85.9%
Validation Efficiency
Allele List at MGI

All alleles(108) : Gene trapped(108)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,270,809 (GRCm39) D124E possibly damaging Het
Aarsd1 T C 11: 101,302,227 (GRCm39) T278A probably benign Het
Acacb T A 5: 114,357,020 (GRCm39) L1317Q probably damaging Het
Acsf3 T C 8: 123,510,741 (GRCm39) V293A probably damaging Het
Adora3 A C 3: 105,812,152 (GRCm39) N13H possibly damaging Het
Aen A T 7: 78,557,073 (GRCm39) D307V probably damaging Het
Ahnak G A 19: 8,993,343 (GRCm39) D4876N probably damaging Het
Ap2b1 T A 11: 83,281,561 (GRCm39) N822K probably damaging Het
Arhgdia T C 11: 120,470,244 (GRCm39) D143G probably benign Het
Bcl9 G T 3: 97,122,713 (GRCm39) R29S probably benign Het
Bhmt2 T A 13: 93,798,998 (GRCm39) K274N probably benign Het
Brip1 C A 11: 86,029,641 (GRCm39) G631V probably damaging Het
Cacna1i A G 15: 80,243,145 (GRCm39) E434G probably damaging Het
Ccdc81 T C 7: 89,515,819 (GRCm39) E620G possibly damaging Het
Cdhr18 A C 14: 13,828,607 (GRCm38) Y718D probably damaging Het
Cfap299 A G 5: 98,949,690 (GRCm39) N208S probably benign Het
Cit A G 5: 116,071,545 (GRCm39) Y584C probably damaging Het
Crebl2 T C 6: 134,828,059 (GRCm39) M77T probably benign Het
Dach2 G A X: 112,208,305 (GRCm39) G61D probably benign Het
Ddx4 A T 13: 112,759,199 (GRCm39) D237E probably damaging Het
Dgcr8 A G 16: 18,096,218 (GRCm39) I490T possibly damaging Het
Dmxl1 G A 18: 49,992,202 (GRCm39) R316H probably benign Het
Dnah17 T A 11: 117,998,987 (GRCm39) I929F possibly damaging Het
Eif3f A G 7: 108,539,958 (GRCm39) T289A probably benign Het
Ercc5 A T 1: 44,215,136 (GRCm39) K890* probably null Het
Esrp2 A T 8: 106,860,489 (GRCm39) V247E probably damaging Het
Evpl C T 11: 116,118,402 (GRCm39) G735E probably damaging Het
Ezhip GTCATCATCATCATC GTCATCATCATCATCATC X: 5,994,645 (GRCm39) probably benign Het
Fbxl21 A G 13: 56,674,906 (GRCm39) I60V probably benign Het
Frem3 A G 8: 81,340,514 (GRCm39) I936V probably benign Het
Fsd1l T C 4: 53,696,984 (GRCm39) probably null Het
Gad1-ps T C 10: 99,281,444 (GRCm39) noncoding transcript Het
Gbp2b A G 3: 142,314,063 (GRCm39) T448A probably benign Het
Gfus G T 15: 75,798,838 (GRCm39) T123N possibly damaging Het
Gmppa T C 1: 75,419,152 (GRCm39) V353A probably damaging Het
Hmcn1 T C 1: 150,453,046 (GRCm39) E5423G probably benign Het
Hmgxb3 A G 18: 61,270,473 (GRCm39) probably null Het
Krt12 T C 11: 99,309,402 (GRCm39) D286G probably damaging Het
Krt75 A T 15: 101,479,532 (GRCm39) M266K probably damaging Het
Ksr1 C A 11: 78,911,204 (GRCm39) V11F probably null Het
Lag3 T C 6: 124,886,402 (GRCm39) N184D probably damaging Het
Lsm10 C G 4: 125,991,741 (GRCm39) D32E probably benign Het
Mettl5 A G 2: 69,711,149 (GRCm39) V123A probably damaging Het
Mfrp A G 9: 44,014,785 (GRCm39) D274G possibly damaging Het
Mgat3 A G 15: 80,095,820 (GRCm39) I216V probably benign Het
Mkrn3 G A 7: 62,068,486 (GRCm39) A435V probably benign Het
Mob3a G A 10: 80,527,068 (GRCm39) Q86* probably null Het
Mplkipl1 A G 19: 61,164,136 (GRCm39) F100L probably damaging Het
Mttp A T 3: 137,798,376 (GRCm39) V840D probably damaging Het
Nadk2 A C 15: 9,103,446 (GRCm39) N308H possibly damaging Het
Nlk T A 11: 78,477,754 (GRCm39) I330F probably damaging Het
Ofcc1 T C 13: 40,360,100 (GRCm39) S310G possibly damaging Het
Or5p57 T C 7: 107,665,985 (GRCm39) N7D probably benign Het
Or5p73 A T 7: 108,064,947 (GRCm39) M139L probably benign Het
Orc2 T C 1: 58,510,247 (GRCm39) probably null Het
Orc3 A G 4: 34,584,829 (GRCm39) Y459H probably damaging Het
Pah T A 10: 87,364,190 (GRCm39) N30K possibly damaging Het
Pcsk4 T C 10: 80,164,794 (GRCm39) K74E probably benign Het
Pdlim7 C T 13: 55,653,981 (GRCm39) G212D probably benign Het
Pfkm A G 15: 98,025,627 (GRCm39) N547S probably damaging Het
Por A G 5: 135,763,128 (GRCm39) E546G probably damaging Het
Ppp1r13l T C 7: 19,111,496 (GRCm39) S774P probably damaging Het
Prdm1 T A 10: 44,315,754 (GRCm39) D794V probably damaging Het
Prdx5 A G 19: 6,885,558 (GRCm39) I32T probably benign Het
Prlhr G T 19: 60,455,932 (GRCm39) C211* probably null Het
Ripk3 C T 14: 56,025,694 (GRCm39) probably null Het
Rmnd5b G A 11: 51,518,465 (GRCm39) A137V probably damaging Het
Rwdd2b A T 16: 87,234,013 (GRCm39) F72I probably benign Het
Scml4 A G 10: 42,788,223 (GRCm39) Y51C probably damaging Het
Septin1 A G 7: 126,813,937 (GRCm39) probably benign Het
Serpinb9h C T 13: 33,588,203 (GRCm39) R263C possibly damaging Het
Slc30a10 T A 1: 185,195,061 (GRCm39) I291N probably damaging Het
Slc7a9 T G 7: 35,152,827 (GRCm39) C20W possibly damaging Het
Slc7a9 G C 7: 35,152,828 (GRCm39) A21P probably damaging Het
Slco1b2 A T 6: 141,628,951 (GRCm39) Y551F probably damaging Het
Sra1 T C 18: 36,801,830 (GRCm39) M87V probably benign Het
Syvn1 T C 19: 6,099,257 (GRCm39) S169P possibly damaging Het
Tmc7 A T 7: 118,160,310 (GRCm39) F176I possibly damaging Het
Tmem62 A T 2: 120,817,151 (GRCm39) I236F probably damaging Het
Trip4 T A 9: 65,782,163 (GRCm39) I190F probably null Het
Trpa1 T C 1: 14,959,649 (GRCm39) D679G probably benign Het
Ttc22 T A 4: 106,494,063 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tyrp1 T A 4: 80,759,043 (GRCm39) probably null Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Usp36 A T 11: 118,163,784 (GRCm39) Y255N probably damaging Het
Zfp944 A T 17: 22,558,960 (GRCm39) Y96N probably benign Het
Other mutations in Ncoa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ncoa7 APN 10 30,566,836 (GRCm39) missense probably damaging 1.00
IGL01716:Ncoa7 APN 10 30,538,330 (GRCm39) missense probably damaging 0.96
IGL02114:Ncoa7 APN 10 30,538,360 (GRCm39) missense probably damaging 1.00
IGL02170:Ncoa7 APN 10 30,565,849 (GRCm39) missense possibly damaging 0.94
IGL02436:Ncoa7 APN 10 30,570,143 (GRCm39) missense probably damaging 1.00
IGL02499:Ncoa7 APN 10 30,566,885 (GRCm39) missense probably benign 0.04
IGL02533:Ncoa7 APN 10 30,598,781 (GRCm39) missense probably damaging 1.00
IGL02533:Ncoa7 APN 10 30,566,895 (GRCm39) missense possibly damaging 0.87
IGL02590:Ncoa7 APN 10 30,570,159 (GRCm39) missense probably damaging 1.00
IGL02657:Ncoa7 APN 10 30,528,972 (GRCm39) missense probably damaging 1.00
IGL03065:Ncoa7 APN 10 30,523,993 (GRCm39) missense probably damaging 1.00
IGL03088:Ncoa7 APN 10 30,574,121 (GRCm39) splice site probably null
IGL03090:Ncoa7 APN 10 30,538,396 (GRCm39) missense probably damaging 0.96
IGL03196:Ncoa7 APN 10 30,523,510 (GRCm39) utr 3 prime probably benign
D6062:Ncoa7 UTSW 10 30,598,651 (GRCm39) missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30,523,537 (GRCm39) missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30,523,537 (GRCm39) missense probably damaging 1.00
R0578:Ncoa7 UTSW 10 30,577,913 (GRCm39) critical splice donor site probably null
R0729:Ncoa7 UTSW 10 30,567,575 (GRCm39) missense probably benign 0.00
R1538:Ncoa7 UTSW 10 30,570,207 (GRCm39) missense probably damaging 0.99
R1539:Ncoa7 UTSW 10 30,647,725 (GRCm39) missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30,570,097 (GRCm39) missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30,570,097 (GRCm39) missense probably damaging 1.00
R1624:Ncoa7 UTSW 10 30,580,655 (GRCm39) missense possibly damaging 0.87
R1639:Ncoa7 UTSW 10 30,577,988 (GRCm39) missense probably damaging 1.00
R1655:Ncoa7 UTSW 10 30,574,241 (GRCm39) critical splice acceptor site probably null
R1876:Ncoa7 UTSW 10 30,574,122 (GRCm39) intron probably benign
R1885:Ncoa7 UTSW 10 30,524,448 (GRCm39) missense possibly damaging 0.81
R1887:Ncoa7 UTSW 10 30,524,448 (GRCm39) missense possibly damaging 0.81
R1909:Ncoa7 UTSW 10 30,565,796 (GRCm39) missense probably damaging 1.00
R1938:Ncoa7 UTSW 10 30,574,166 (GRCm39) missense probably benign 0.02
R1965:Ncoa7 UTSW 10 30,530,426 (GRCm39) nonsense probably null
R1978:Ncoa7 UTSW 10 30,567,295 (GRCm39) missense probably benign
R2303:Ncoa7 UTSW 10 30,530,431 (GRCm39) missense probably damaging 1.00
R3777:Ncoa7 UTSW 10 30,565,752 (GRCm39) missense probably damaging 1.00
R3778:Ncoa7 UTSW 10 30,565,752 (GRCm39) missense probably damaging 1.00
R4026:Ncoa7 UTSW 10 30,598,720 (GRCm39) missense probably benign 0.02
R4230:Ncoa7 UTSW 10 30,574,253 (GRCm39) splice site probably null
R4667:Ncoa7 UTSW 10 30,566,786 (GRCm39) missense probably damaging 1.00
R4786:Ncoa7 UTSW 10 30,531,638 (GRCm39) missense probably benign 0.28
R4809:Ncoa7 UTSW 10 30,647,758 (GRCm39) missense possibly damaging 0.92
R4820:Ncoa7 UTSW 10 30,524,472 (GRCm39) missense probably damaging 1.00
R4839:Ncoa7 UTSW 10 30,598,655 (GRCm39) missense possibly damaging 0.93
R4861:Ncoa7 UTSW 10 30,580,608 (GRCm39) missense probably benign
R4861:Ncoa7 UTSW 10 30,580,608 (GRCm39) missense probably benign
R5271:Ncoa7 UTSW 10 30,598,725 (GRCm39) missense probably benign 0.02
R5384:Ncoa7 UTSW 10 30,598,813 (GRCm39) missense probably benign 0.00
R5418:Ncoa7 UTSW 10 30,524,035 (GRCm39) missense probably damaging 1.00
R5964:Ncoa7 UTSW 10 30,580,632 (GRCm39) missense probably damaging 1.00
R6257:Ncoa7 UTSW 10 30,570,173 (GRCm39) missense probably damaging 1.00
R6683:Ncoa7 UTSW 10 30,647,717 (GRCm39) missense probably damaging 0.99
R6813:Ncoa7 UTSW 10 30,572,188 (GRCm39) missense probably damaging 1.00
R6910:Ncoa7 UTSW 10 30,570,117 (GRCm39) missense possibly damaging 0.89
R7123:Ncoa7 UTSW 10 30,530,435 (GRCm39) missense probably benign 0.28
R7327:Ncoa7 UTSW 10 30,565,796 (GRCm39) missense probably damaging 1.00
R7412:Ncoa7 UTSW 10 30,598,847 (GRCm39) missense possibly damaging 0.94
R7638:Ncoa7 UTSW 10 30,598,794 (GRCm39) missense probably benign 0.35
R7653:Ncoa7 UTSW 10 30,570,239 (GRCm39) missense probably damaging 1.00
R7848:Ncoa7 UTSW 10 30,524,414 (GRCm39) missense possibly damaging 0.82
R7861:Ncoa7 UTSW 10 30,567,056 (GRCm39) missense probably benign 0.38
R8125:Ncoa7 UTSW 10 30,570,087 (GRCm39) missense possibly damaging 0.80
R8198:Ncoa7 UTSW 10 30,580,664 (GRCm39) missense probably benign 0.00
R8240:Ncoa7 UTSW 10 30,567,725 (GRCm39) missense probably benign 0.45
R8353:Ncoa7 UTSW 10 30,570,155 (GRCm39) missense probably damaging 1.00
R8509:Ncoa7 UTSW 10 30,572,048 (GRCm39) missense probably benign 0.00
R8861:Ncoa7 UTSW 10 30,567,364 (GRCm39) missense probably benign 0.02
R9040:Ncoa7 UTSW 10 30,530,389 (GRCm39) missense probably benign 0.00
R9136:Ncoa7 UTSW 10 30,567,628 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTCCTTGTGCTGGGTTTC -3'
(R):5'- ACATGGGTTCCAGTTAGAGC -3'

Sequencing Primer
(F):5'- TCTAAGCTGTCTGTATGCTTCAG -3'
(R):5'- TTGCTGAAAGAGTTATAAGATCCAAG -3'
Posted On 2014-06-30