Incidental Mutation 'R0119:Zbtb18'
ID20956
Institutional Source Beutler Lab
Gene Symbol Zbtb18
Ensembl Gene ENSMUSG00000063659
Gene Namezinc finger and BTB domain containing 18
SynonymsRP58, Zfp238
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0119 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location177442351-177450764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 177448157 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 361 (E361G)
Ref Sequence ENSEMBL: ENSMUSP00000091831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077225] [ENSMUST00000094276] [ENSMUST00000192699] [ENSMUST00000192851] [ENSMUST00000193440] [ENSMUST00000193480] [ENSMUST00000194319] [ENSMUST00000195002] [ENSMUST00000195388] [ENSMUST00000195549] [ENSMUST00000195612]
Predicted Effect probably benign
Transcript: ENSMUST00000077225
AA Change: E352G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000076463
Gene: ENSMUSG00000063659
AA Change: E352G

DomainStartEndE-ValueType
BTB 24 121 2.55e-22 SMART
ZnF_C2H2 370 392 1.28e-3 SMART
ZnF_C2H2 410 432 1.01e-1 SMART
ZnF_C2H2 438 460 9.58e-3 SMART
ZnF_C2H2 466 489 1.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094276
AA Change: E361G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000091831
Gene: ENSMUSG00000063659
AA Change: E361G

DomainStartEndE-ValueType
BTB 33 130 2.55e-22 SMART
ZnF_C2H2 379 401 1.28e-3 SMART
ZnF_C2H2 419 441 1.01e-1 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 498 1.18e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180591
Predicted Effect probably benign
Transcript: ENSMUST00000192699
Predicted Effect probably benign
Transcript: ENSMUST00000192851
SMART Domains Protein: ENSMUSP00000142256
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193440
SMART Domains Protein: ENSMUSP00000141337
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193480
SMART Domains Protein: ENSMUSP00000141663
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 33 130 1.6e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194269
Predicted Effect probably benign
Transcript: ENSMUST00000194319
Predicted Effect probably benign
Transcript: ENSMUST00000195002
Predicted Effect probably benign
Transcript: ENSMUST00000195388
SMART Domains Protein: ENSMUSP00000141694
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195549
SMART Domains Protein: ENSMUSP00000142073
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195612
AA Change: E352G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141724
Gene: ENSMUSG00000063659
AA Change: E352G

DomainStartEndE-ValueType
BTB 24 121 2.55e-22 SMART
ZnF_C2H2 370 392 1.28e-3 SMART
ZnF_C2H2 410 432 1.01e-1 SMART
ZnF_C2H2 438 460 9.58e-3 SMART
ZnF_C2H2 466 489 1.18e-2 SMART
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein which acts a transcriptional repressor of genes involved in neuronal development. The encoded protein recognizes a specific sequence motif and recruits components of chromatin to target genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cortical and hippocampal hypoplasia and laminar disorganization, and abnormal neuron apoptosis and cell cycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Zbtb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Zbtb18 APN 1 177447983 missense probably benign 0.01
IGL01967:Zbtb18 APN 1 177447782 missense probably benign 0.25
PIT4434001:Zbtb18 UTSW 1 177448423 missense possibly damaging 0.93
R0085:Zbtb18 UTSW 1 177447935 missense probably benign 0.00
R0309:Zbtb18 UTSW 1 177448616 missense probably damaging 0.99
R1614:Zbtb18 UTSW 1 177447170 missense probably damaging 1.00
R1660:Zbtb18 UTSW 1 177447763 missense probably benign 0.05
R1676:Zbtb18 UTSW 1 177447347 unclassified probably null
R1750:Zbtb18 UTSW 1 177447511 missense possibly damaging 0.95
R2365:Zbtb18 UTSW 1 177448157 missense probably benign 0.05
R4282:Zbtb18 UTSW 1 177447479 missense probably damaging 1.00
R4497:Zbtb18 UTSW 1 177447121 missense probably damaging 1.00
R4542:Zbtb18 UTSW 1 177448666 missense probably damaging 0.99
R4678:Zbtb18 UTSW 1 177447719 missense probably benign 0.04
R5450:Zbtb18 UTSW 1 177447205 missense probably damaging 1.00
R5726:Zbtb18 UTSW 1 177448553 missense probably damaging 1.00
R5828:Zbtb18 UTSW 1 177447880 missense probably damaging 0.98
R5879:Zbtb18 UTSW 1 177448370 missense probably damaging 1.00
R6379:Zbtb18 UTSW 1 177447575 missense probably damaging 0.99
R6641:Zbtb18 UTSW 1 177448043 missense probably damaging 0.98
R7088:Zbtb18 UTSW 1 177447254 missense probably damaging 1.00
R7779:Zbtb18 UTSW 1 177446939 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTGTCTGTCAAGTCCAGCCTTTCAG -3'
(R):5'- CATGCAGGAGAAAGTCTTCCCACAC -3'

Sequencing Primer
(F):5'- CCAGCCTTTCAGGAGTTGAAAATC -3'
(R):5'- TCTTCCCACACAGGGAGC -3'
Posted On2013-04-11