Incidental Mutation 'R1886:Usp36'
ID 209574
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Name ubiquitin specific peptidase 36
Synonyms 2700002L06Rik
MMRRC Submission 039907-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R1886 (G1)
Quality Score 195
Status Not validated
Chromosome 11
Chromosomal Location 118150477-118181070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118163784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 255 (Y255N)
Ref Sequence ENSEMBL: ENSMUSP00000122761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
AlphaFold B1AQJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000092382
AA Change: Y420N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: Y420N

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106296
AA Change: Y420N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: Y420N

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144153
AA Change: Y255N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: Y255N

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.2%
  • 10x: 93.1%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,270,809 (GRCm39) D124E possibly damaging Het
Aarsd1 T C 11: 101,302,227 (GRCm39) T278A probably benign Het
Acacb T A 5: 114,357,020 (GRCm39) L1317Q probably damaging Het
Acsf3 T C 8: 123,510,741 (GRCm39) V293A probably damaging Het
Adora3 A C 3: 105,812,152 (GRCm39) N13H possibly damaging Het
Aen A T 7: 78,557,073 (GRCm39) D307V probably damaging Het
Ahnak G A 19: 8,993,343 (GRCm39) D4876N probably damaging Het
Ap2b1 T A 11: 83,281,561 (GRCm39) N822K probably damaging Het
Arhgdia T C 11: 120,470,244 (GRCm39) D143G probably benign Het
Bcl9 G T 3: 97,122,713 (GRCm39) R29S probably benign Het
Bhmt2 T A 13: 93,798,998 (GRCm39) K274N probably benign Het
Brip1 C A 11: 86,029,641 (GRCm39) G631V probably damaging Het
Cacna1i A G 15: 80,243,145 (GRCm39) E434G probably damaging Het
Ccdc81 T C 7: 89,515,819 (GRCm39) E620G possibly damaging Het
Cdhr18 A C 14: 13,828,607 (GRCm38) Y718D probably damaging Het
Cfap299 A G 5: 98,949,690 (GRCm39) N208S probably benign Het
Cit A G 5: 116,071,545 (GRCm39) Y584C probably damaging Het
Crebl2 T C 6: 134,828,059 (GRCm39) M77T probably benign Het
Dach2 G A X: 112,208,305 (GRCm39) G61D probably benign Het
Ddx4 A T 13: 112,759,199 (GRCm39) D237E probably damaging Het
Dgcr8 A G 16: 18,096,218 (GRCm39) I490T possibly damaging Het
Dmxl1 G A 18: 49,992,202 (GRCm39) R316H probably benign Het
Dnah17 T A 11: 117,998,987 (GRCm39) I929F possibly damaging Het
Eif3f A G 7: 108,539,958 (GRCm39) T289A probably benign Het
Ercc5 A T 1: 44,215,136 (GRCm39) K890* probably null Het
Esrp2 A T 8: 106,860,489 (GRCm39) V247E probably damaging Het
Evpl C T 11: 116,118,402 (GRCm39) G735E probably damaging Het
Ezhip GTCATCATCATCATC GTCATCATCATCATCATC X: 5,994,645 (GRCm39) probably benign Het
Fbxl21 A G 13: 56,674,906 (GRCm39) I60V probably benign Het
Frem3 A G 8: 81,340,514 (GRCm39) I936V probably benign Het
Fsd1l T C 4: 53,696,984 (GRCm39) probably null Het
Gad1-ps T C 10: 99,281,444 (GRCm39) noncoding transcript Het
Gbp2b A G 3: 142,314,063 (GRCm39) T448A probably benign Het
Gfus G T 15: 75,798,838 (GRCm39) T123N possibly damaging Het
Gmppa T C 1: 75,419,152 (GRCm39) V353A probably damaging Het
Hmcn1 T C 1: 150,453,046 (GRCm39) E5423G probably benign Het
Hmgxb3 A G 18: 61,270,473 (GRCm39) probably null Het
Krt12 T C 11: 99,309,402 (GRCm39) D286G probably damaging Het
Krt75 A T 15: 101,479,532 (GRCm39) M266K probably damaging Het
Ksr1 C A 11: 78,911,204 (GRCm39) V11F probably null Het
Lag3 T C 6: 124,886,402 (GRCm39) N184D probably damaging Het
Lsm10 C G 4: 125,991,741 (GRCm39) D32E probably benign Het
Mettl5 A G 2: 69,711,149 (GRCm39) V123A probably damaging Het
Mfrp A G 9: 44,014,785 (GRCm39) D274G possibly damaging Het
Mgat3 A G 15: 80,095,820 (GRCm39) I216V probably benign Het
Mkrn3 G A 7: 62,068,486 (GRCm39) A435V probably benign Het
Mob3a G A 10: 80,527,068 (GRCm39) Q86* probably null Het
Mplkipl1 A G 19: 61,164,136 (GRCm39) F100L probably damaging Het
Mttp A T 3: 137,798,376 (GRCm39) V840D probably damaging Het
Nadk2 A C 15: 9,103,446 (GRCm39) N308H possibly damaging Het
Ncoa7 T C 10: 30,524,448 (GRCm39) N823S possibly damaging Het
Nlk T A 11: 78,477,754 (GRCm39) I330F probably damaging Het
Ofcc1 T C 13: 40,360,100 (GRCm39) S310G possibly damaging Het
Or5p57 T C 7: 107,665,985 (GRCm39) N7D probably benign Het
Or5p73 A T 7: 108,064,947 (GRCm39) M139L probably benign Het
Orc2 T C 1: 58,510,247 (GRCm39) probably null Het
Orc3 A G 4: 34,584,829 (GRCm39) Y459H probably damaging Het
Pah T A 10: 87,364,190 (GRCm39) N30K possibly damaging Het
Pcsk4 T C 10: 80,164,794 (GRCm39) K74E probably benign Het
Pdlim7 C T 13: 55,653,981 (GRCm39) G212D probably benign Het
Pfkm A G 15: 98,025,627 (GRCm39) N547S probably damaging Het
Por A G 5: 135,763,128 (GRCm39) E546G probably damaging Het
Ppp1r13l T C 7: 19,111,496 (GRCm39) S774P probably damaging Het
Prdm1 T A 10: 44,315,754 (GRCm39) D794V probably damaging Het
Prdx5 A G 19: 6,885,558 (GRCm39) I32T probably benign Het
Prlhr G T 19: 60,455,932 (GRCm39) C211* probably null Het
Ripk3 C T 14: 56,025,694 (GRCm39) probably null Het
Rmnd5b G A 11: 51,518,465 (GRCm39) A137V probably damaging Het
Rwdd2b A T 16: 87,234,013 (GRCm39) F72I probably benign Het
Scml4 A G 10: 42,788,223 (GRCm39) Y51C probably damaging Het
Septin1 A G 7: 126,813,937 (GRCm39) probably benign Het
Serpinb9h C T 13: 33,588,203 (GRCm39) R263C possibly damaging Het
Slc30a10 T A 1: 185,195,061 (GRCm39) I291N probably damaging Het
Slc7a9 T G 7: 35,152,827 (GRCm39) C20W possibly damaging Het
Slc7a9 G C 7: 35,152,828 (GRCm39) A21P probably damaging Het
Slco1b2 A T 6: 141,628,951 (GRCm39) Y551F probably damaging Het
Sra1 T C 18: 36,801,830 (GRCm39) M87V probably benign Het
Syvn1 T C 19: 6,099,257 (GRCm39) S169P possibly damaging Het
Tmc7 A T 7: 118,160,310 (GRCm39) F176I possibly damaging Het
Tmem62 A T 2: 120,817,151 (GRCm39) I236F probably damaging Het
Trip4 T A 9: 65,782,163 (GRCm39) I190F probably null Het
Trpa1 T C 1: 14,959,649 (GRCm39) D679G probably benign Het
Ttc22 T A 4: 106,494,063 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tyrp1 T A 4: 80,759,043 (GRCm39) probably null Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Zfp944 A T 17: 22,558,960 (GRCm39) Y96N probably benign Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118,155,646 (GRCm39) missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118,176,786 (GRCm39) missense probably damaging 1.00
IGL01720:Usp36 APN 11 118,165,828 (GRCm39) missense probably damaging 0.99
IGL02410:Usp36 APN 11 118,167,011 (GRCm39) missense probably damaging 1.00
IGL02700:Usp36 APN 11 118,166,983 (GRCm39) missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118,155,609 (GRCm39) missense probably benign 0.22
IGL03145:Usp36 APN 11 118,170,067 (GRCm39) missense probably damaging 1.00
IGL03203:Usp36 APN 11 118,176,636 (GRCm39) missense probably benign 0.42
IGL03265:Usp36 APN 11 118,155,635 (GRCm39) missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R0499:Usp36 UTSW 11 118,164,397 (GRCm39) missense probably damaging 0.98
R0606:Usp36 UTSW 11 118,153,854 (GRCm39) splice site probably benign
R0646:Usp36 UTSW 11 118,163,847 (GRCm39) missense probably damaging 1.00
R1579:Usp36 UTSW 11 118,175,771 (GRCm39) missense probably damaging 1.00
R1646:Usp36 UTSW 11 118,164,392 (GRCm39) missense probably damaging 1.00
R1716:Usp36 UTSW 11 118,162,957 (GRCm39) critical splice donor site probably null
R2014:Usp36 UTSW 11 118,153,334 (GRCm39) splice site probably benign
R2068:Usp36 UTSW 11 118,165,844 (GRCm39) missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118,159,491 (GRCm39) missense probably benign 0.02
R2191:Usp36 UTSW 11 118,175,849 (GRCm39) missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118,167,582 (GRCm39) splice site probably benign
R3176:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3177:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3276:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3277:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3615:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3616:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3768:Usp36 UTSW 11 118,153,878 (GRCm39) missense probably damaging 1.00
R3899:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118,176,621 (GRCm39) missense probably damaging 0.99
R4809:Usp36 UTSW 11 118,153,896 (GRCm39) missense probably damaging 1.00
R5135:Usp36 UTSW 11 118,155,731 (GRCm39) missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R6226:Usp36 UTSW 11 118,168,100 (GRCm39) missense probably damaging 1.00
R6266:Usp36 UTSW 11 118,159,411 (GRCm39) missense probably damaging 1.00
R7191:Usp36 UTSW 11 118,159,660 (GRCm39) missense probably benign 0.39
R7215:Usp36 UTSW 11 118,155,980 (GRCm39) missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118,164,355 (GRCm39) missense probably damaging 1.00
R7535:Usp36 UTSW 11 118,152,872 (GRCm39) missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118,154,522 (GRCm39) missense probably benign 0.11
R7843:Usp36 UTSW 11 118,176,791 (GRCm39) missense probably damaging 1.00
R8228:Usp36 UTSW 11 118,155,716 (GRCm39) missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118,165,840 (GRCm39) missense probably damaging 1.00
R8935:Usp36 UTSW 11 118,167,657 (GRCm39) critical splice acceptor site probably null
R8995:Usp36 UTSW 11 118,175,825 (GRCm39) missense probably damaging 1.00
R9024:Usp36 UTSW 11 118,166,983 (GRCm39) missense possibly damaging 0.95
R9325:Usp36 UTSW 11 118,160,031 (GRCm39) missense possibly damaging 0.69
R9529:Usp36 UTSW 11 118,159,461 (GRCm39) nonsense probably null
R9774:Usp36 UTSW 11 118,153,875 (GRCm39) missense probably damaging 1.00
X0020:Usp36 UTSW 11 118,164,439 (GRCm39) missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118,167,026 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAGTGGCCTTTCACCC -3'
(R):5'- AAGTGCAGTTAGCCTCTGTC -3'

Sequencing Primer
(F):5'- TGAAAGGTCCTTCCCAGAGGAC -3'
(R):5'- CTGTCTGTCACAAATAAAGCAGTGG -3'
Posted On 2014-06-30