Incidental Mutation 'R0119:Pde5a'
ID20959
Institutional Source Beutler Lab
Gene Symbol Pde5a
Ensembl Gene ENSMUSG00000053965
Gene Namephosphodiesterase 5A, cGMP-specific
SynonymsPDE5A1, Pde5
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R0119 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location122728947-122859374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122748458 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 199 (N199S)
Ref Sequence ENSEMBL: ENSMUSP00000143042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066728] [ENSMUST00000200389]
Predicted Effect probably damaging
Transcript: ENSMUST00000066728
AA Change: N231S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069011
Gene: ENSMUSG00000053965
AA Change: N231S

DomainStartEndE-ValueType
Blast:GAF 64 152 4e-42 BLAST
GAF 154 314 2.23e-31 SMART
GAF 336 503 9.8e-28 SMART
HDc 600 768 8.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198314
Predicted Effect probably damaging
Transcript: ENSMUST00000200389
AA Change: N199S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143042
Gene: ENSMUSG00000053965
AA Change: N199S

DomainStartEndE-ValueType
Blast:GAF 32 120 3e-42 BLAST
GAF 122 282 1.1e-33 SMART
GAF 304 471 4.7e-30 SMART
HDc 568 736 4.4e-11 SMART
Meta Mutation Damage Score 0.4876 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cGMP-binding, cGMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family. This phosphodiesterase specifically hydrolyzes cGMP to 5'-GMP. It is involved in the regulation of intracellular concentrations of cyclic nucleotides and is important for smooth muscle relaxation in the cardiovascular system. Alternative splicing of this gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Pde5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pde5a APN 3 122794357 missense probably damaging 1.00
IGL00945:Pde5a APN 3 122835642 critical splice donor site probably null
IGL01395:Pde5a APN 3 122817955 missense probably benign 0.40
IGL01872:Pde5a APN 3 122794369 critical splice donor site probably null
IGL01947:Pde5a APN 3 122835610 missense probably damaging 1.00
IGL02033:Pde5a APN 3 122803061 missense possibly damaging 0.51
IGL02209:Pde5a APN 3 122825015 splice site probably benign
IGL02220:Pde5a APN 3 122748382 missense probably benign 0.05
IGL02301:Pde5a APN 3 122760885 missense probably damaging 1.00
IGL02748:Pde5a APN 3 122760892 missense probably damaging 0.99
R0009:Pde5a UTSW 3 122824902 splice site probably benign
R0031:Pde5a UTSW 3 122803055 missense probably benign 0.00
R0390:Pde5a UTSW 3 122835583 missense probably damaging 1.00
R0481:Pde5a UTSW 3 122818077 splice site probably benign
R0499:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0657:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R0845:Pde5a UTSW 3 122729331 missense probably benign 0.28
R0908:Pde5a UTSW 3 122779001 missense probably benign 0.01
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1147:Pde5a UTSW 3 122794313 missense probably damaging 1.00
R1553:Pde5a UTSW 3 122778936 missense probably benign 0.14
R1728:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R1744:Pde5a UTSW 3 122747897 missense probably damaging 0.97
R1774:Pde5a UTSW 3 122729364 missense probably benign 0.01
R1784:Pde5a UTSW 3 122748240 missense probably damaging 1.00
R2437:Pde5a UTSW 3 122843053 missense probably damaging 1.00
R2844:Pde5a UTSW 3 122851708 missense probably damaging 1.00
R2897:Pde5a UTSW 3 122779002 missense probably benign 0.03
R2936:Pde5a UTSW 3 122794319 missense probably damaging 0.97
R3160:Pde5a UTSW 3 122781628 nonsense probably null
R3162:Pde5a UTSW 3 122781628 nonsense probably null
R3704:Pde5a UTSW 3 122779019 missense probably benign 0.00
R3847:Pde5a UTSW 3 122803160 missense probably damaging 0.98
R3932:Pde5a UTSW 3 122760896 missense probably damaging 0.98
R4387:Pde5a UTSW 3 122729352 missense probably benign 0.00
R4613:Pde5a UTSW 3 122823093 missense probably damaging 1.00
R4676:Pde5a UTSW 3 122747893 missense possibly damaging 0.67
R5034:Pde5a UTSW 3 122852586 missense probably damaging 1.00
R5034:Pde5a UTSW 3 122852587 missense probably damaging 1.00
R5358:Pde5a UTSW 3 122748176 missense probably damaging 1.00
R5394:Pde5a UTSW 3 122818009 missense probably damaging 1.00
R5502:Pde5a UTSW 3 122803032 missense probably damaging 1.00
R5821:Pde5a UTSW 3 122817955 missense probably benign 0.40
R5932:Pde5a UTSW 3 122841044 missense probably benign 0.01
R6063:Pde5a UTSW 3 122824925 missense probably benign 0.23
R6190:Pde5a UTSW 3 122729307 missense probably benign 0.28
R6815:Pde5a UTSW 3 122824924 missense probably benign 0.01
R6940:Pde5a UTSW 3 122779032 missense possibly damaging 0.53
R7274:Pde5a UTSW 3 122855246 nonsense probably null
R7337:Pde5a UTSW 3 122748458 missense probably damaging 1.00
R7384:Pde5a UTSW 3 122825000 missense probably damaging 1.00
R7480:Pde5a UTSW 3 122803148 missense possibly damaging 0.50
R7508:Pde5a UTSW 3 122818030 missense probably damaging 1.00
R7522:Pde5a UTSW 3 122840999 nonsense probably null
R7623:Pde5a UTSW 3 122774601 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAATTTGACCGACCTCTTAGACCC -3'
(R):5'- AGCAGTGCTCCTATCCTAGACTCTTTG -3'

Sequencing Primer
(F):5'- CCCCCCAAGATTTGATAGTGATG -3'
(R):5'- agattcaatccaagactttgcac -3'
Posted On2013-04-11