Incidental Mutation 'R1886:Sra1'
ID 209598
Institutional Source Beutler Lab
Gene Symbol Sra1
Ensembl Gene ENSMUSG00000006050
Gene Name steroid receptor RNA activator 1
Synonyms Srap
MMRRC Submission 039907-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1886 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 36800240-36803364 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36801830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 87 (M87V)
Ref Sequence ENSEMBL: ENSMUSP00000133360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036765] [ENSMUST00000142977] [ENSMUST00000173875]
AlphaFold Q80VJ2
PDB Structure Solution structure of mouse Steroid receptor RNA activator 1 (SRA1) protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000001415
SMART Domains Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
WW 30 61 1.72e-7 SMART
low complexity region 85 100 N/A INTRINSIC
PTB 114 260 7.64e-37 SMART
PTB 286 420 4.07e-32 SMART
low complexity region 444 468 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000006209
AA Change: M79V
SMART Domains Protein: ENSMUSP00000006209
Gene: ENSMUSG00000006050
AA Change: M79V

DomainStartEndE-ValueType
Pfam:SRA1 65 208 1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036765
SMART Domains Protein: ENSMUSP00000039298
Gene: ENSMUSG00000090264

DomainStartEndE-ValueType
Pfam:eIF_4EBP 3 101 4.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140061
SMART Domains Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 355 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142977
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173202
Predicted Effect probably benign
Transcript: ENSMUST00000173875
AA Change: M87V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133360
Gene: ENSMUSG00000006050
AA Change: M87V

DomainStartEndE-ValueType
Pfam:SRA1 72 217 1.1e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174125
Predicted Effect probably benign
Transcript: ENSMUST00000173482
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.2%
  • 10x: 93.1%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mice are protected against diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,270,809 (GRCm39) D124E possibly damaging Het
Aarsd1 T C 11: 101,302,227 (GRCm39) T278A probably benign Het
Acacb T A 5: 114,357,020 (GRCm39) L1317Q probably damaging Het
Acsf3 T C 8: 123,510,741 (GRCm39) V293A probably damaging Het
Adora3 A C 3: 105,812,152 (GRCm39) N13H possibly damaging Het
Aen A T 7: 78,557,073 (GRCm39) D307V probably damaging Het
Ahnak G A 19: 8,993,343 (GRCm39) D4876N probably damaging Het
Ap2b1 T A 11: 83,281,561 (GRCm39) N822K probably damaging Het
Arhgdia T C 11: 120,470,244 (GRCm39) D143G probably benign Het
Bcl9 G T 3: 97,122,713 (GRCm39) R29S probably benign Het
Bhmt2 T A 13: 93,798,998 (GRCm39) K274N probably benign Het
Brip1 C A 11: 86,029,641 (GRCm39) G631V probably damaging Het
Cacna1i A G 15: 80,243,145 (GRCm39) E434G probably damaging Het
Ccdc81 T C 7: 89,515,819 (GRCm39) E620G possibly damaging Het
Cdhr18 A C 14: 13,828,607 (GRCm38) Y718D probably damaging Het
Cfap299 A G 5: 98,949,690 (GRCm39) N208S probably benign Het
Cit A G 5: 116,071,545 (GRCm39) Y584C probably damaging Het
Crebl2 T C 6: 134,828,059 (GRCm39) M77T probably benign Het
Dach2 G A X: 112,208,305 (GRCm39) G61D probably benign Het
Ddx4 A T 13: 112,759,199 (GRCm39) D237E probably damaging Het
Dgcr8 A G 16: 18,096,218 (GRCm39) I490T possibly damaging Het
Dmxl1 G A 18: 49,992,202 (GRCm39) R316H probably benign Het
Dnah17 T A 11: 117,998,987 (GRCm39) I929F possibly damaging Het
Eif3f A G 7: 108,539,958 (GRCm39) T289A probably benign Het
Ercc5 A T 1: 44,215,136 (GRCm39) K890* probably null Het
Esrp2 A T 8: 106,860,489 (GRCm39) V247E probably damaging Het
Evpl C T 11: 116,118,402 (GRCm39) G735E probably damaging Het
Ezhip GTCATCATCATCATC GTCATCATCATCATCATC X: 5,994,645 (GRCm39) probably benign Het
Fbxl21 A G 13: 56,674,906 (GRCm39) I60V probably benign Het
Frem3 A G 8: 81,340,514 (GRCm39) I936V probably benign Het
Fsd1l T C 4: 53,696,984 (GRCm39) probably null Het
Gad1-ps T C 10: 99,281,444 (GRCm39) noncoding transcript Het
Gbp2b A G 3: 142,314,063 (GRCm39) T448A probably benign Het
Gfus G T 15: 75,798,838 (GRCm39) T123N possibly damaging Het
Gmppa T C 1: 75,419,152 (GRCm39) V353A probably damaging Het
Hmcn1 T C 1: 150,453,046 (GRCm39) E5423G probably benign Het
Hmgxb3 A G 18: 61,270,473 (GRCm39) probably null Het
Krt12 T C 11: 99,309,402 (GRCm39) D286G probably damaging Het
Krt75 A T 15: 101,479,532 (GRCm39) M266K probably damaging Het
Ksr1 C A 11: 78,911,204 (GRCm39) V11F probably null Het
Lag3 T C 6: 124,886,402 (GRCm39) N184D probably damaging Het
Lsm10 C G 4: 125,991,741 (GRCm39) D32E probably benign Het
Mettl5 A G 2: 69,711,149 (GRCm39) V123A probably damaging Het
Mfrp A G 9: 44,014,785 (GRCm39) D274G possibly damaging Het
Mgat3 A G 15: 80,095,820 (GRCm39) I216V probably benign Het
Mkrn3 G A 7: 62,068,486 (GRCm39) A435V probably benign Het
Mob3a G A 10: 80,527,068 (GRCm39) Q86* probably null Het
Mplkipl1 A G 19: 61,164,136 (GRCm39) F100L probably damaging Het
Mttp A T 3: 137,798,376 (GRCm39) V840D probably damaging Het
Nadk2 A C 15: 9,103,446 (GRCm39) N308H possibly damaging Het
Ncoa7 T C 10: 30,524,448 (GRCm39) N823S possibly damaging Het
Nlk T A 11: 78,477,754 (GRCm39) I330F probably damaging Het
Ofcc1 T C 13: 40,360,100 (GRCm39) S310G possibly damaging Het
Or5p57 T C 7: 107,665,985 (GRCm39) N7D probably benign Het
Or5p73 A T 7: 108,064,947 (GRCm39) M139L probably benign Het
Orc2 T C 1: 58,510,247 (GRCm39) probably null Het
Orc3 A G 4: 34,584,829 (GRCm39) Y459H probably damaging Het
Pah T A 10: 87,364,190 (GRCm39) N30K possibly damaging Het
Pcsk4 T C 10: 80,164,794 (GRCm39) K74E probably benign Het
Pdlim7 C T 13: 55,653,981 (GRCm39) G212D probably benign Het
Pfkm A G 15: 98,025,627 (GRCm39) N547S probably damaging Het
Por A G 5: 135,763,128 (GRCm39) E546G probably damaging Het
Ppp1r13l T C 7: 19,111,496 (GRCm39) S774P probably damaging Het
Prdm1 T A 10: 44,315,754 (GRCm39) D794V probably damaging Het
Prdx5 A G 19: 6,885,558 (GRCm39) I32T probably benign Het
Prlhr G T 19: 60,455,932 (GRCm39) C211* probably null Het
Ripk3 C T 14: 56,025,694 (GRCm39) probably null Het
Rmnd5b G A 11: 51,518,465 (GRCm39) A137V probably damaging Het
Rwdd2b A T 16: 87,234,013 (GRCm39) F72I probably benign Het
Scml4 A G 10: 42,788,223 (GRCm39) Y51C probably damaging Het
Septin1 A G 7: 126,813,937 (GRCm39) probably benign Het
Serpinb9h C T 13: 33,588,203 (GRCm39) R263C possibly damaging Het
Slc30a10 T A 1: 185,195,061 (GRCm39) I291N probably damaging Het
Slc7a9 T G 7: 35,152,827 (GRCm39) C20W possibly damaging Het
Slc7a9 G C 7: 35,152,828 (GRCm39) A21P probably damaging Het
Slco1b2 A T 6: 141,628,951 (GRCm39) Y551F probably damaging Het
Syvn1 T C 19: 6,099,257 (GRCm39) S169P possibly damaging Het
Tmc7 A T 7: 118,160,310 (GRCm39) F176I possibly damaging Het
Tmem62 A T 2: 120,817,151 (GRCm39) I236F probably damaging Het
Trip4 T A 9: 65,782,163 (GRCm39) I190F probably null Het
Trpa1 T C 1: 14,959,649 (GRCm39) D679G probably benign Het
Ttc22 T A 4: 106,494,063 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tyrp1 T A 4: 80,759,043 (GRCm39) probably null Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Usp36 A T 11: 118,163,784 (GRCm39) Y255N probably damaging Het
Zfp944 A T 17: 22,558,960 (GRCm39) Y96N probably benign Het
Other mutations in Sra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Sra1 APN 18 36,801,792 (GRCm39) missense probably benign 0.36
IGL01390:Sra1 APN 18 36,803,134 (GRCm39) missense probably damaging 1.00
IGL01645:Sra1 APN 18 36,804,526 (GRCm39) missense probably damaging 1.00
IGL02478:Sra1 APN 18 36,801,845 (GRCm39) missense probably benign 0.00
IGL02578:Sra1 APN 18 36,803,150 (GRCm39) nonsense probably null
R0218:Sra1 UTSW 18 36,809,662 (GRCm39) unclassified probably benign
R0243:Sra1 UTSW 18 36,808,759 (GRCm39) nonsense probably null
R0432:Sra1 UTSW 18 36,810,556 (GRCm39) missense probably benign
R0834:Sra1 UTSW 18 36,801,829 (GRCm39) missense probably benign 0.00
R2105:Sra1 UTSW 18 36,808,121 (GRCm39) missense probably benign 0.00
R2911:Sra1 UTSW 18 36,809,238 (GRCm39) missense possibly damaging 0.49
R4951:Sra1 UTSW 18 36,809,494 (GRCm39) nonsense probably null
R5034:Sra1 UTSW 18 36,812,048 (GRCm39) critical splice donor site probably null
R5091:Sra1 UTSW 18 36,803,012 (GRCm39) intron probably benign
R5122:Sra1 UTSW 18 36,800,647 (GRCm39) missense probably benign 0.03
R5656:Sra1 UTSW 18 36,811,460 (GRCm39) missense probably damaging 0.99
R5722:Sra1 UTSW 18 36,808,031 (GRCm39) missense probably damaging 1.00
R5726:Sra1 UTSW 18 36,803,226 (GRCm39) intron probably benign
R5729:Sra1 UTSW 18 36,800,496 (GRCm39) utr 3 prime probably benign
R5937:Sra1 UTSW 18 36,804,652 (GRCm39) splice site probably null
R6145:Sra1 UTSW 18 36,800,628 (GRCm39) missense probably damaging 1.00
R6161:Sra1 UTSW 18 36,803,336 (GRCm39) missense probably damaging 0.99
R7423:Sra1 UTSW 18 36,800,536 (GRCm39) missense probably benign 0.00
R8074:Sra1 UTSW 18 36,808,064 (GRCm39) missense possibly damaging 0.89
R8100:Sra1 UTSW 18 36,809,948 (GRCm39) missense probably damaging 1.00
R8483:Sra1 UTSW 18 36,800,879 (GRCm39) missense probably benign
R9040:Sra1 UTSW 18 36,808,790 (GRCm39) missense probably damaging 1.00
R9044:Sra1 UTSW 18 36,800,946 (GRCm39) missense probably benign 0.00
R9428:Sra1 UTSW 18 36,810,299 (GRCm39) missense probably damaging 1.00
Z1176:Sra1 UTSW 18 36,803,062 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAGATTGCTTAAGAGGCC -3'
(R):5'- TGTAATTGGCTCAATGCTGTGAAC -3'

Sequencing Primer
(F):5'- TTAAGAGGCCATCAGAAACTCTGTC -3'
(R):5'- GCTCAATGCTGTGAACAAAGTTAAG -3'
Posted On 2014-06-30